ID: 1112374476

View in Genome Browser
Species Human (GRCh38)
Location 13:98825881-98825903
Sequence TCCTCCTCAGGCAGGCGCTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112374469_1112374476 -2 Left 1112374469 13:98825860-98825882 CCTCAGGCTCACCTCCCCGGCTC 0: 1
1: 1
2: 4
3: 35
4: 373
Right 1112374476 13:98825881-98825903 TCCTCCTCAGGCAGGCGCTATGG 0: 1
1: 0
2: 1
3: 11
4: 122
1112374465_1112374476 16 Left 1112374465 13:98825842-98825864 CCCGGGGGCTGGGCTGATCCTCA 0: 1
1: 0
2: 2
3: 25
4: 308
Right 1112374476 13:98825881-98825903 TCCTCCTCAGGCAGGCGCTATGG 0: 1
1: 0
2: 1
3: 11
4: 122
1112374466_1112374476 15 Left 1112374466 13:98825843-98825865 CCGGGGGCTGGGCTGATCCTCAG 0: 1
1: 0
2: 1
3: 39
4: 314
Right 1112374476 13:98825881-98825903 TCCTCCTCAGGCAGGCGCTATGG 0: 1
1: 0
2: 1
3: 11
4: 122
1112374464_1112374476 17 Left 1112374464 13:98825841-98825863 CCCCGGGGGCTGGGCTGATCCTC 0: 1
1: 0
2: 1
3: 22
4: 355
Right 1112374476 13:98825881-98825903 TCCTCCTCAGGCAGGCGCTATGG 0: 1
1: 0
2: 1
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112374476 Original CRISPR TCCTCCTCAGGCAGGCGCTA TGG Exonic