ID: 1112374986

View in Genome Browser
Species Human (GRCh38)
Location 13:98830752-98830774
Sequence CACTCCATGAGGGCTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112374979_1112374986 8 Left 1112374979 13:98830721-98830743 CCAGAGCTTGTCTGTGACCTCCA 0: 1
1: 0
2: 1
3: 16
4: 278
Right 1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG 0: 1
1: 0
2: 5
3: 49
4: 375
1112374980_1112374986 -9 Left 1112374980 13:98830738-98830760 CCTCCATTAGACTACACTCCATG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG 0: 1
1: 0
2: 5
3: 49
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112374986 Original CRISPR CACTCCATGAGGGCTGGGAG AGG Intronic
900476770 1:2879753-2879775 CACTCACCGAGGGCCGGGAGGGG + Intergenic
900591907 1:3463921-3463943 CCCTCCACCAAGGCTGGGAGCGG - Intronic
902891438 1:19447108-19447130 CACCCAGTGAGGGCTGGGATGGG - Intronic
902896188 1:19481740-19481762 CACCCCAAAAGGCCTGGGAGTGG + Intronic
903435243 1:23344296-23344318 CAGTCCATCAGGGGGGGGAGGGG - Exonic
903696437 1:25210801-25210823 CCCTCCCTGAGGTCTGGGGGTGG + Intergenic
904286490 1:29456008-29456030 CAGTGCATGAGGGCTGTGGGAGG + Intergenic
904344932 1:29861584-29861606 CACCCCATGAGGGCTGCAATGGG + Intergenic
904495207 1:30882564-30882586 CACCCCATCAGGGCTGTGATGGG + Intronic
905914663 1:41676366-41676388 CACTCCCTGAGGCCTGGGTGAGG + Intronic
906097826 1:43236102-43236124 CACTCCCTGATGGCTGGCAGAGG + Intronic
906558802 1:46738337-46738359 AATTTCATGAGGGCTGAGAGAGG - Intergenic
906607262 1:47181177-47181199 CCCTCCCTCAGGGCTGGGGGTGG + Intergenic
906813052 1:48849016-48849038 GGCTCCAGGTGGGCTGGGAGGGG + Intronic
907550715 1:55302529-55302551 GACTCCAAAAGGGCTGGCAGAGG - Intergenic
908333225 1:63092654-63092676 CATTCTATGAAGGCTGAGAGAGG - Intergenic
908340744 1:63176222-63176244 CATTCTATGAAGGCTGAGAGAGG - Intergenic
909499806 1:76321401-76321423 CAAACCATGGGGGATGGGAGGGG - Intronic
910298332 1:85675916-85675938 AACTCTATGAAGGCTGAGAGAGG - Intronic
910904442 1:92160451-92160473 CAGTCCATGAGAACTGGAAGAGG - Intergenic
911712661 1:101093130-101093152 TATTCCATGAAGGCTGAGAGAGG - Intergenic
912549279 1:110474196-110474218 AGCTCCCTGAGGGCAGGGAGAGG + Intergenic
912731438 1:112109949-112109971 CAGTCTATGAAGGCTGTGAGAGG - Intergenic
912762313 1:112379966-112379988 CTCTCCATCTGGGGTGGGAGTGG - Intergenic
915339398 1:155167968-155167990 CTATCCCTGAGGGCCGGGAGTGG - Intergenic
915465167 1:156093178-156093200 AAGTCCATGTGGGCTGGGAGTGG - Intronic
915736029 1:158085839-158085861 AACTCCTTGAGGGCAGGGAAGGG - Intronic
916930619 1:169574934-169574956 AACTCTATGAAGGCAGGGAGTGG - Intronic
918466611 1:184827336-184827358 CACTCGATCAGGGCAGGGTGGGG - Intronic
922253676 1:223872962-223872984 AATTCCATGAGGACTGGGAGAGG + Intergenic
922305578 1:224341121-224341143 CTCCCCACGAGGCCTGGGAGCGG + Intergenic
922333192 1:224595874-224595896 AATTCTATGAGGGCTGAGAGAGG + Intronic
922622964 1:227005005-227005027 CGCTCCATGAGTGCTAGCAGTGG - Exonic
922867655 1:228873865-228873887 CACTGAAGGAGGGCTGGGATGGG + Intergenic
923541363 1:234890559-234890581 CTCTCCATGCAGGCTGGGTGCGG - Intergenic
1062893872 10:1088095-1088117 AATTCCCTGAGGGCTGTGAGAGG - Intronic
1063105504 10:2988356-2988378 CATTCCATGTGGACTGGGAGTGG - Intergenic
1063520786 10:6738751-6738773 CACTCTGTAAGGGCTGGGATAGG + Intergenic
1063788588 10:9413244-9413266 CATTCTATGAAGGCTGAGAGAGG + Intergenic
1064017157 10:11781519-11781541 CAATCCCTGAGGGGTGGCAGCGG + Intergenic
1064097784 10:12436637-12436659 TCCTCCATGAGGGCTGAGATGGG - Intronic
1064266240 10:13827803-13827825 CACGCCAGGAGGAGTGGGAGAGG + Intronic
1066237885 10:33504642-33504664 AATTCCATGAAGGCTGAGAGAGG - Intergenic
1067301824 10:45018600-45018622 AATTCCATGAAGGCTGAGAGAGG - Intergenic
1067791062 10:49288187-49288209 CCCTCCATGAAGGCCAGGAGTGG + Intergenic
1068132829 10:52916088-52916110 CACTCCTGGAGGGGTGGGAGTGG + Intergenic
1069873222 10:71545890-71545912 CACTCCCTGGGGGGTGGGGGTGG - Intronic
1070008249 10:72446617-72446639 TACTCCATTAGGGCTGGGCCTGG - Intronic
1070153203 10:73817996-73818018 CACTGAATGAGGGCTACGAGTGG - Intronic
1070626324 10:78053814-78053836 GACTCTTTGAGGGCTGGAAGTGG + Intronic
1073644584 10:105287400-105287422 TACTCCATCATGGCTGGAAGTGG + Intergenic
1073954693 10:108856983-108857005 CACTCCATGTGGGCTGCACGTGG - Intergenic
1074205324 10:111277968-111277990 AATTCCTTGAGGGCTGGGACTGG - Intergenic
1074915452 10:117950835-117950857 CATTTCCTCAGGGCTGGGAGAGG + Intergenic
1075315941 10:121453691-121453713 CACTTCATCAGGCCTGGGGGTGG - Intergenic
1077251837 11:1564200-1564222 CAAGCCATGGGGGCAGGGAGGGG + Intronic
1077508900 11:2945219-2945241 AACTGCAGGAGGGGTGGGAGAGG + Exonic
1078086680 11:8237678-8237700 CTCCCCACGAGGGCAGGGAGAGG + Intronic
1078397709 11:10996030-10996052 CTCTCTCTGAGAGCTGGGAGAGG + Intergenic
1078430124 11:11281900-11281922 CCCTCCCTGGAGGCTGGGAGGGG + Intronic
1078710862 11:13789621-13789643 CACTCCATGGGGTATGGGGGAGG + Intergenic
1078784269 11:14472829-14472851 AATTCCATGAAGGCTGAGAGAGG - Intronic
1079075713 11:17384372-17384394 GACTGCATGGGTGCTGGGAGAGG + Intergenic
1080060326 11:27949928-27949950 GACTCCATGTGGGAAGGGAGAGG - Intergenic
1080133645 11:28827296-28827318 CAGTCCATGAAGACTGGGAGAGG - Intergenic
1080406740 11:31986805-31986827 AGTTCCATGAGGGCAGGGAGTGG - Intronic
1080494976 11:32808346-32808368 CAGGCCATGTGGGCTGGGCGCGG + Intergenic
1080586951 11:33691107-33691129 CACAGGATGGGGGCTGGGAGTGG - Intergenic
1081141656 11:39508744-39508766 AAGTACATGAGGGCTGGGCGCGG + Intergenic
1083803496 11:65059949-65059971 CTCTCCGTGAGGTCTGGAAGAGG - Intergenic
1084032320 11:66488188-66488210 CAATCCCTGAGGGCTGGCAAGGG + Intronic
1084178881 11:67437004-67437026 CTCTCCCTGAGGCCTGGGATGGG + Intronic
1084365040 11:68692354-68692376 CACTACCTCCGGGCTGGGAGTGG - Intergenic
1084366103 11:68700430-68700452 AACTGCATGTGGGCTGGGTGCGG + Intergenic
1085079461 11:73622073-73622095 AACTCAGTGAGGGCTGGGTGTGG - Intergenic
1085369201 11:75982491-75982513 CACTGCATTGGGGGTGGGAGAGG + Intronic
1085386287 11:76160087-76160109 CACTTCATGGGGCCTGGCAGGGG + Intergenic
1085455452 11:76662879-76662901 CACTGCATGTGGGCTGGGGTGGG - Intronic
1085674855 11:78506966-78506988 GCCTCCCTCAGGGCTGGGAGAGG - Intronic
1085920468 11:80949143-80949165 TAGTCCATAAAGGCTGGGAGAGG + Intergenic
1086153008 11:83633573-83633595 AAGTCCATGGGGGCTGGGAGAGG + Intronic
1086899921 11:92355350-92355372 TACTCCATCAGGGATGGCAGTGG + Exonic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1088738681 11:112749157-112749179 CCCTGCATGAGGCCAGGGAGAGG + Intergenic
1089168034 11:116492841-116492863 CACTCCAGAAGGACTGGGGGAGG + Intergenic
1089436513 11:118473416-118473438 CACTCCATGAGGACAAGAAGTGG + Exonic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1089794002 11:120965928-120965950 AACTCCATGAAGGCTGGATGTGG - Intronic
1090638321 11:128707644-128707666 AACTCCAAGAAGGCAGGGAGGGG - Intronic
1091704026 12:2681626-2681648 AGCTCCAGGAGGACTGGGAGGGG - Intronic
1091829037 12:3536240-3536262 CTCTCCCTGAAGGCTGGGAGTGG - Intronic
1091836641 12:3590888-3590910 AGCTCCATGAGGGCAGGGACCGG - Intronic
1091875878 12:3932361-3932383 GACACCATCAGGGCAGGGAGAGG - Intergenic
1093136528 12:15458941-15458963 CAGTCCATGAAGGCTGGAAGAGG - Intronic
1093838341 12:23864668-23864690 AATTCCATGAAGGCTGAGAGAGG + Intronic
1093946297 12:25113588-25113610 AACTAGATGAGGGCTGGGAGCGG - Intronic
1095719355 12:45384182-45384204 CACTCTATGAAGGCTGAGAGAGG - Intronic
1096076133 12:48806229-48806251 TACTGCATGATGGCTGGGCGCGG + Intergenic
1096532020 12:52248389-52248411 CACTACAAGAGGGCAGGGTGGGG + Intronic
1097047034 12:56194904-56194926 AACTTCATGAGGGATGGCAGGGG - Intergenic
1098354748 12:69601775-69601797 CACTCAATCATGGCTGGGTGCGG + Intergenic
1098890007 12:76000489-76000511 CTTTCCATGAAGGCTGAGAGAGG - Intergenic
1098921733 12:76308764-76308786 CATTCCATGAAGGCTGGGAGAGG - Intergenic
1099116030 12:78625121-78625143 CACTCCATGAAGGCTGGCAGTGG - Intergenic
1100010590 12:89948046-89948068 CACTCCATGCTGACTGAGAGTGG + Intergenic
1100180401 12:92079246-92079268 AACTCCATGAGGGGAGGGGGAGG + Intronic
1100390956 12:94146517-94146539 CATTCCAGGAGGGCAGGGAGTGG + Intergenic
1101624335 12:106424142-106424164 GACACCATGAGGGCTGGGCTCGG - Intronic
1103039982 12:117686926-117686948 CAGTTCCTGAGGGCTTGGAGAGG + Intronic
1103156322 12:118688189-118688211 CATTCTTTGAGGGCTGGGTGGGG + Intergenic
1103322856 12:120101905-120101927 GACTGCATGATGGCAGGGAGGGG + Intronic
1103851450 12:123936180-123936202 CACTCCATGAGGGAGGAGAGGGG + Exonic
1105404782 13:20124497-20124519 CACTCCATGGTGTCGGGGAGAGG + Intergenic
1106711621 13:32341980-32342002 CCTCCCATGAGGGCTGGGCGTGG + Intronic
1107010885 13:35669862-35669884 CTCTTCTTGAGGGCTGGGAAGGG + Intronic
1108472301 13:50779658-50779680 CAATCCGTGAGACCTGGGAGAGG - Intronic
1109547661 13:63848566-63848588 AACTACATGAGAGCTGGGTGAGG - Intergenic
1111991733 13:95123649-95123671 CACTCAGAGAGGGCTGGGTGTGG - Intronic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1113743425 13:112726209-112726231 CACTGCATGCGTGCAGGGAGAGG + Intronic
1113743456 13:112726341-112726363 CACTGCATGCGTGCAGGGAGAGG + Intronic
1114398601 14:22388982-22389004 CTCTCTTTGAGGGCTGGCAGAGG - Intergenic
1114523123 14:23351428-23351450 CAGTCCATGTGGGCTGTTAGTGG + Intronic
1114628096 14:24142388-24142410 CCCTCCTTAAGGGCTAGGAGGGG - Intergenic
1118315169 14:64721703-64721725 ATCTCCAGGAGGGATGGGAGGGG + Intronic
1119705679 14:76781326-76781348 CACTCCCTGAAAGCTGGGATGGG - Exonic
1121028957 14:90641382-90641404 GACTCCCTGAAGCCTGGGAGTGG - Intronic
1121586017 14:95063631-95063653 CACCCACTGAGCGCTGGGAGTGG - Intergenic
1121928164 14:97948165-97948187 GACTCCATGAGTGGTGAGAGAGG + Intronic
1126362137 15:47857596-47857618 CACTCCTTGAGGGCAGGGATTGG + Intergenic
1127261663 15:57331265-57331287 CACTCCATGAAGGCAGCAAGGGG - Intergenic
1128730157 15:70015447-70015469 CATGCCATGAGGCCTGGGTGGGG + Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1132039011 15:98509158-98509180 CACACCATCAGGGCTGGGCATGG + Intronic
1132856487 16:2047391-2047413 CACTGCAGGAGGGCGGGGATGGG + Intronic
1132907667 16:2291438-2291460 AACTGCATGGGGGCTGGGCGTGG - Intronic
1133707330 16:8367303-8367325 AGCTCCATGAGGGCAGGCAGTGG - Intergenic
1134760835 16:16713460-16713482 AACTCCTTGAAGGCTGGGAGTGG + Intergenic
1134985223 16:18645713-18645735 AACTCCTTGAAGGCTGGGAGTGG - Intergenic
1135621750 16:23961938-23961960 TACTCCATAAGGACTGAGAGTGG + Intronic
1136427655 16:30180020-30180042 CACTCCATGAGGTTCAGGAGGGG - Intergenic
1136546052 16:30955457-30955479 CACTCAGGGAGGGCTGGGTGTGG - Intronic
1137592538 16:49702576-49702598 CTCTCCTTGAGGGCTGGGGGTGG - Intronic
1138183878 16:54961891-54961913 CACCCCAAAAGAGCTGGGAGGGG + Intergenic
1138246849 16:55473877-55473899 AACTCTATGAAGGCTGAGAGAGG - Intronic
1138367049 16:56488717-56488739 CACTCCCTGGAGGTTGGGAGAGG + Intronic
1138541423 16:57689954-57689976 AACTGCTTGTGGGCTGGGAGGGG - Intergenic
1138555203 16:57766849-57766871 GACTGCAGGAGGGCTGGGGGTGG - Intronic
1140674764 16:77316955-77316977 AACTCCATGTGGGCTGGGTATGG - Intronic
1140834812 16:78783508-78783530 CTCTGAATGAGAGCTGGGAGAGG + Intronic
1141858442 16:86700787-86700809 CACTCAAGGAGGGCTGGACGGGG - Intergenic
1141978352 16:87533452-87533474 CATTCCATCAAGGCTGAGAGTGG + Intergenic
1142045665 16:87923573-87923595 CACTGCATGAGGTCTTGGTGAGG + Intronic
1142550037 17:732719-732741 GGCTCCATCCGGGCTGGGAGCGG - Exonic
1143035662 17:3995287-3995309 CACTTCATCAGGGCTGGGCATGG + Intergenic
1143345184 17:6244026-6244048 CACTGGAGGAGGGATGGGAGGGG + Intergenic
1143473545 17:7190802-7190824 CCCTCCACGATGGCTGGGAGTGG + Exonic
1144876001 17:18397574-18397596 CACTCCAGGAGGGGCTGGAGTGG + Intergenic
1145156227 17:20546846-20546868 CACTCCAGGAGGGGCTGGAGTGG - Intergenic
1145278765 17:21453629-21453651 GTCACCATGTGGGCTGGGAGGGG - Intergenic
1146446444 17:32936477-32936499 CACTCCCTGAGGGAAGAGAGGGG + Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1149000431 17:51751964-51751986 AGCTCCATGATGGCAGGGAGAGG - Intronic
1149433272 17:56611727-56611749 CTCTCCATGAGAGCTGGGGTTGG - Intergenic
1149818480 17:59750590-59750612 CACTCATTGTGGGCTGGGCGTGG - Intronic
1151146731 17:72048082-72048104 CAATACATGGGGGCTGGGCGCGG + Intergenic
1151334963 17:73434350-73434372 CCTTCCTTGAGGGCTGGGATGGG - Intronic
1152298622 17:79482870-79482892 CATTGCAAGCGGGCTGGGAGAGG - Intronic
1152642012 17:81453151-81453173 CACTCCAGGGGGGCCGGGCGGGG - Intronic
1152664914 17:81562246-81562268 CAACCCATGAGGGCCGGGCGCGG + Intronic
1153077898 18:1186741-1186763 AGCTCCATGAGGGCAGGGACTGG + Intergenic
1154033614 18:10776674-10776696 CATTCCCTGAGGAGTGGGAGCGG + Intronic
1154079050 18:11236137-11236159 GACTCCAGGAGGGATGGGAATGG - Intergenic
1154200196 18:12294244-12294266 CACTCCATCACAGCTGTGAGTGG + Intergenic
1154323398 18:13372191-13372213 CACTTCCTGAGGGCAGGGACCGG - Intronic
1155620135 18:27768866-27768888 GAGTCAATGATGGCTGGGAGCGG - Intergenic
1155645330 18:28070679-28070701 AGCTCTGTGAGGGCTGGGAGTGG - Intronic
1155741246 18:29290817-29290839 AATTCTATGAAGGCTGGGAGAGG + Intergenic
1157496550 18:48161270-48161292 TTCTCCAGGAGGGCTGGGAGTGG + Intronic
1158919220 18:62170977-62170999 CAATCTATGAAGGCTGAGAGAGG + Intronic
1159038831 18:63303663-63303685 CTCTCCCTGAGGGCAGGAAGTGG - Intronic
1159514459 18:69439679-69439701 AATTCCATGAAGGCTGAGAGAGG - Intronic
1160831654 19:1107266-1107288 CCCTCCGTGAGGGCTGGGGATGG + Intergenic
1160935459 19:1592581-1592603 CGCTCCCGCAGGGCTGGGAGAGG - Exonic
1161277396 19:3426367-3426389 CGCCCCATGAGGGCTGGGTGTGG - Intronic
1161381573 19:3968155-3968177 CACTGCATCAGGGCTGGAATAGG - Intronic
1161805767 19:6442147-6442169 CCCTCGATGGAGGCTGGGAGGGG + Exonic
1162688816 19:12412101-12412123 CAGTCCATGTGGGCTGTGGGGGG - Intronic
1163128232 19:15255967-15255989 CACCCAATGAGGACAGGGAGGGG + Intronic
1163501382 19:17678614-17678636 CGCTCCCTGGGGGCTGGGTGGGG - Intronic
1163527018 19:17827635-17827657 AAATCCATAAGGGCTGGGCGCGG - Intronic
1163633846 19:18429583-18429605 CACTCCCCGAGGGTGGGGAGGGG - Intronic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1163764770 19:19157120-19157142 CAATGCATGAGAGCTGGAAGTGG - Intronic
1164792284 19:30997436-30997458 CACTCCACGTGGGTTGGGTGAGG - Intergenic
1164808709 19:31139341-31139363 CAATCCATGTGGGCAGGGAGGGG - Intergenic
1164983311 19:32630309-32630331 CAGTCCGTGAGTGCTGGGCGAGG - Intronic
1165961423 19:39537873-39537895 CACATCATTAGGGCTGGGCGCGG + Intergenic
1166284565 19:41816454-41816476 TACTGCATGATGGCTGGGCGTGG - Intergenic
1166382996 19:42364771-42364793 CTCTCCCTGAGGTCTTGGAGAGG - Intronic
1167530135 19:50010620-50010642 CTCTCCAAGAAGGCTGGGCGTGG + Intronic
925164141 2:1705278-1705300 CCCTCCATGAAGGCTGGGGTTGG + Intronic
925687938 2:6492401-6492423 AACTGCATGAGAGCTGGGTGAGG + Intergenic
926057522 2:9783270-9783292 CTCTCTATGAAGGCTGAGAGGGG + Intergenic
926442196 2:12901505-12901527 GAATTCATGAAGGCTGGGAGTGG + Intergenic
926450020 2:12991632-12991654 AATTCCATGAAGGCTGAGAGAGG + Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
929120034 2:38476823-38476845 GACTTGAGGAGGGCTGGGAGGGG + Intergenic
929323235 2:40572256-40572278 AATTCCATGAAGGCTGAGAGAGG + Intronic
929587772 2:43126991-43127013 AAGTCCATGTGGGATGGGAGCGG + Intergenic
930035860 2:47084613-47084635 CAGACCATGAGGCCTGAGAGAGG + Intronic
930035867 2:47084643-47084665 CAGACCATGAGGCCTGAGAGAGG + Intronic
930035881 2:47084703-47084725 CAGACCATGAGGCCTGAGAGAGG + Intronic
930322114 2:49868671-49868693 CATTCTATGAAGGCTGAGAGAGG - Intergenic
931133870 2:59374233-59374255 TACTCCATTACGGCTGGGTGTGG - Intergenic
932240291 2:70151031-70151053 AACTTCATGATGGCTGGGCGTGG - Intronic
932306895 2:70710304-70710326 CACTCCATGGGGAAGGGGAGAGG - Intronic
933025678 2:77255330-77255352 CACTGCTTGAGAGATGGGAGTGG - Intronic
933328364 2:80866848-80866870 AACTCTATGAAGGCTGTGAGAGG - Intergenic
933387001 2:81623559-81623581 AATGCCATGAGGGCTGAGAGAGG - Intergenic
933868027 2:86541718-86541740 TACTCCTTCATGGCTGGGAGTGG + Intronic
937525451 2:122763461-122763483 CAGTCCATGAAGACTGGGAGAGG - Intergenic
937928354 2:127185108-127185130 AACTCCATGGGGGCTGGGCGTGG - Exonic
939185888 2:138860706-138860728 AATTCCATGAAGGCTGAGAGAGG - Intergenic
941128034 2:161610561-161610583 CACTCCATAATGACTGGAAGTGG + Intronic
942481330 2:176391667-176391689 CACAGACTGAGGGCTGGGAGGGG + Intergenic
943083951 2:183289652-183289674 AATTCCATGAAGGCTGAGAGAGG + Intergenic
943097012 2:183441494-183441516 CAGTCAATGAGGGCAAGGAGAGG - Intergenic
943479781 2:188404403-188404425 CACACCAAGAGGGCTGGGGTTGG - Intronic
944255761 2:197622086-197622108 CATTCTATGAAGGCTGAGAGAGG + Intronic
944271096 2:197785899-197785921 CTGTCCCTGAGGGCTTGGAGGGG - Intronic
945358597 2:208868108-208868130 CCGTCCACGAGGGCTGTGAGTGG + Intergenic
946575266 2:221068724-221068746 CATTCTATGAAGGCTGAGAGTGG + Intergenic
948087042 2:235259451-235259473 CTCTCCATCAGGGCTGGGATTGG - Intergenic
948827094 2:240578091-240578113 CAGTGCAAGAGAGCTGGGAGTGG - Exonic
948857761 2:240738127-240738149 CCCTCCCCGAGGGCTGAGAGTGG - Intronic
948896445 2:240930060-240930082 CTCTCCATGGGGGCTGGAAGTGG - Intronic
948909798 2:240997340-240997362 CACCCCATGCAGGGTGGGAGAGG + Intergenic
948955085 2:241283209-241283231 AATTCCATGAAGGCTGAGAGAGG + Intronic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1168964703 20:1892423-1892445 GACTCCATCTGGGGTGGGAGTGG - Intergenic
1169341422 20:4799376-4799398 CACTCCAGGTGGGATGAGAGGGG + Intronic
1171309344 20:24134130-24134152 AAGTACATGAGGGGTGGGAGGGG + Intergenic
1171336270 20:24388520-24388542 CTCACCATGAGGGCTGTGTGAGG + Intergenic
1173251003 20:41364231-41364253 CCCTCCCTGTGGGCAGGGAGGGG + Intronic
1173450485 20:43159253-43159275 CATGCCATGAGAGCTGGGGGTGG + Intronic
1176883442 21:14226326-14226348 AACTACATGTGGGCTGGGTGCGG + Intronic
1177076998 21:16588485-16588507 CAGTCCAGCAGGTCTGGGAGAGG + Intergenic
1179929120 21:44555621-44555643 CACCACATAAGGACTGGGAGGGG - Intronic
1180887810 22:19260105-19260127 AATTCCATGAAGGCTGAGAGAGG + Intronic
1181514836 22:23404595-23404617 TGCTCCAGGAGGGGTGGGAGGGG - Intergenic
1181534088 22:23532921-23532943 ACCTCCATGCGGCCTGGGAGGGG - Intergenic
1182355941 22:29722239-29722261 CACTCCCTGAGGAAGGGGAGAGG + Intronic
1183188204 22:36304611-36304633 CACTGCGCTAGGGCTGGGAGTGG + Intronic
1183366961 22:37411945-37411967 CAGTCCCTGAGGGCTGGGAGTGG - Intronic
1183378204 22:37477300-37477322 CACTCCATGTGGCTTGGGAGGGG + Intronic
1184685925 22:46096335-46096357 CGCCCACTGAGGGCTGGGAGGGG - Intronic
1185175314 22:49323027-49323049 CCCTCCCTGTGGGCTGGGTGCGG + Intergenic
1185178044 22:49341646-49341668 AATTCCATGAAGGCTGAGAGAGG + Intergenic
949118254 3:355365-355387 CACTCCAAATGGGCTGGGCGGGG + Intronic
949477559 3:4463199-4463221 CACTACATTAGGGCTGGGCGCGG + Intronic
950515934 3:13465332-13465354 CACCCCAAGAGGGTTGGGACTGG - Intergenic
950578367 3:13846754-13846776 CAGTCCCTGAGGACTGGGGGTGG - Intronic
950729213 3:14942185-14942207 CTGTCCTTGAGGGCTGTGAGAGG - Intergenic
951608800 3:24468168-24468190 AATTCCATGAAGGCTGAGAGAGG - Intronic
952901040 3:38111947-38111969 GACTCCATTTGGGATGGGAGTGG + Intronic
953151599 3:40330118-40330140 CACTCCTGGAAGGCAGGGAGTGG + Intergenic
953385547 3:42503845-42503867 CACTCCAAGTTGGCTGGGGGAGG + Intronic
953568908 3:44056487-44056509 CTCACAATAAGGGCTGGGAGTGG - Intergenic
953863637 3:46565577-46565599 CAGTCCCTGAGTTCTGGGAGAGG + Intronic
954438174 3:50506980-50507002 CACTGCATGAGGCTTGGAAGGGG - Intergenic
954763510 3:52894981-52895003 CCCTCCCTCAGGGCTGCGAGGGG + Intronic
956800172 3:72750416-72750438 CACTCCAAGAGGCCAGGAAGAGG + Exonic
957536784 3:81515892-81515914 AATTCTATGAAGGCTGGGAGAGG + Intronic
957765566 3:84620404-84620426 AATTCTATGAAGGCTGGGAGAGG - Intergenic
960540607 3:118857541-118857563 CTCTCTATGAAGGCTGAGAGAGG + Intergenic
960906315 3:122605188-122605210 CACTGGATGAGGGCTGGTGGTGG + Intronic
961382198 3:126503111-126503133 CACTCCAGGTGTGCTGTGAGGGG - Intronic
961412003 3:126729370-126729392 CACTCCAAGGGAGCGGGGAGCGG + Intronic
961427410 3:126858863-126858885 CACAGAATGAGGGCTGGGTGTGG + Intronic
961471288 3:127114801-127114823 CACACCATGCAGGCAGGGAGAGG - Intergenic
962093060 3:132265526-132265548 CTGTCCATGAAGACTGGGAGAGG - Intronic
962315313 3:134355667-134355689 CATTTCTTGAAGGCTGGGAGGGG - Intergenic
962876321 3:139538653-139538675 CCCACCATGGGGGCTGAGAGTGG + Intronic
964853186 3:161117475-161117497 CAGTCCATGAGGGCCAGGCGCGG + Intronic
966106133 3:176336186-176336208 AACTCTATGAAGGCTGAGAGAGG + Intergenic
968078433 3:195829922-195829944 CTCCCCATGAGGGCTGGCTGGGG + Intergenic
969298566 4:6283773-6283795 CAGACCATGAGGACTGAGAGTGG + Intronic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
969704833 4:8786008-8786030 CACTCCAAGAAGCCTAGGAGGGG + Intergenic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
973958554 4:56087301-56087323 TACTCCTTTAGGGCTGGGCGCGG - Intergenic
974377751 4:61099939-61099961 TAATCCATAAGGGCTGGGTGCGG + Intergenic
975746458 4:77480196-77480218 TACACCATCAGGGCTGGGAGCGG + Intergenic
976058463 4:81097814-81097836 AACTCTATGAAGGCTGAGAGAGG - Intronic
976456683 4:85256159-85256181 CAGTCCATAAAGACTGGGAGAGG - Intergenic
976931577 4:90572942-90572964 CAGTCCATGAGGACTGGAATAGG - Intronic
977105904 4:92884242-92884264 AACTCTATGAAGGCTGAGAGAGG - Intronic
977808289 4:101329321-101329343 AATTCCATGAAGGCTGAGAGAGG + Intronic
979576867 4:122302863-122302885 AATTCTATGAAGGCTGGGAGAGG + Intronic
979843091 4:125470653-125470675 CATTGCATGAAGGCTGAGAGAGG - Intronic
980459965 4:133096841-133096863 CTCTCCATCATGACTGGGAGTGG + Intergenic
981490948 4:145338692-145338714 CACTTCTTTAGGGCTGGAAGAGG - Intergenic
981554182 4:145974956-145974978 AAATCCATAAGGGCTGGGTGTGG + Intergenic
982085084 4:151826875-151826897 AACTCTATGAAGGCTGAGAGAGG - Intergenic
982697075 4:158614577-158614599 CATTCTATGAAGGCTGAGAGAGG - Intronic
983228740 4:165109096-165109118 TACTCCATGTTGGCTGGGAATGG + Intronic
985657864 5:1141367-1141389 CTCTCCATTAGGACTGGGAGAGG - Intergenic
986448553 5:7844770-7844792 CACTCCAAGGGGGCTGTGTGGGG - Intronic
987124529 5:14799185-14799207 AATTCCATGAATGCTGGGAGAGG + Intronic
989760134 5:45005382-45005404 AATTCTATGAGGGCTGAGAGAGG + Intergenic
990439223 5:55828027-55828049 CATTCCATGGGGGCTGTGAGAGG - Intergenic
990753507 5:59042628-59042650 AACTCCCTAAAGGCTGGGAGAGG + Intronic
992271312 5:75066205-75066227 CAATTCATGAAGGCTGAGAGAGG + Intergenic
992462815 5:76978044-76978066 CATTCTATGAAGGCTGAGAGAGG + Intronic
994760954 5:103853360-103853382 AATTCCATGAAGGCTGAGAGAGG - Intergenic
996067359 5:119093912-119093934 AATTCCGTGAAGGCTGGGAGAGG + Intronic
997466867 5:134094054-134094076 GACTCCATGAGGCCAGTGAGCGG + Intergenic
998153191 5:139768999-139769021 AATTCCATGAGGGCAGGGACTGG - Intergenic
999116717 5:149170503-149170525 CACTCCATGGGGTTTGGGTGGGG - Intronic
999315471 5:150580733-150580755 CACCCAATGAGGGGTGGGAATGG - Intergenic
999800324 5:155027407-155027429 CAGTCCATGAAGACTAGGAGAGG + Intergenic
1000280043 5:159774277-159774299 CGCTCCATGAGAGCTGGGACAGG - Intergenic
1000586675 5:163108432-163108454 AACTCTATGAAGGCTGAGAGAGG - Intergenic
1000758270 5:165187727-165187749 AACTCTATGAAGGCTGAGAGAGG + Intergenic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002534758 5:179870046-179870068 GACTGCATGAGGGAGGGGAGCGG + Intronic
1002883545 6:1273914-1273936 CCCACCATATGGGCTGGGAGAGG + Intergenic
1002938349 6:1693637-1693659 CACTCCATCTTGGCTGGAAGTGG + Intronic
1003533654 6:6957531-6957553 CACATCATGAGGGCTGGGCGCGG + Intergenic
1003895223 6:10601080-10601102 AACTACCAGAGGGCTGGGAGCGG - Intronic
1005004950 6:21278630-21278652 CCTTCCATGTGAGCTGGGAGGGG + Intergenic
1005943634 6:30580054-30580076 CATTTCATCAGGGCTGGGCGCGG + Intronic
1006274044 6:32987040-32987062 GACTCCATGAGGTCTGACAGTGG - Intergenic
1006674298 6:35751200-35751222 CAGTGAATGAGGGCTGGGCGTGG - Intergenic
1006745471 6:36338873-36338895 GACTCCATGAGGGCTGGGCCAGG - Intergenic
1007390051 6:41545846-41545868 CACTGCGTGGGGGCTGGGGGTGG - Intergenic
1008753920 6:54770789-54770811 CAGTACATGAGGACTGGGCGGGG + Intergenic
1011717476 6:90122500-90122522 TTCTCCTTGAGGGCTGGGATGGG + Intronic
1012300862 6:97586330-97586352 TACTCCATGAGGAATGAGAGAGG - Intergenic
1012824735 6:104133033-104133055 GATTCCATGAAGGCTGAGAGAGG + Intergenic
1017367580 6:153662976-153662998 CAGTCTTTGAGGACTGGGAGAGG - Intergenic
1019478858 7:1256912-1256934 CACCTCATGTGGGCTGGGAGCGG - Intergenic
1020548978 7:9573826-9573848 CACTCTGTGAAGGCTGAGAGAGG - Intergenic
1020765023 7:12308570-12308592 CATTCTATGAAGGCTGAGAGAGG - Intergenic
1021191406 7:17623960-17623982 CACACCATGAGGTAAGGGAGGGG + Intergenic
1021282822 7:18740967-18740989 AATTCTATGAGGGCTGAGAGAGG + Intronic
1021968450 7:25944998-25945020 CGCCCCTTGATGGCTGGGAGTGG + Intergenic
1022785102 7:33630920-33630942 AATCCCATGAGGGCAGGGAGAGG - Intergenic
1022808915 7:33849838-33849860 CACTGGGTGAGGGCTGGAAGAGG + Intergenic
1023737941 7:43251133-43251155 CTCTCCTTGAGGGCTGCAAGGGG + Intronic
1024051105 7:45623977-45623999 CACTCCAGGTGGTCAGGGAGGGG + Intronic
1024109866 7:46134143-46134165 CCCTTCATGTGGGATGGGAGAGG + Intergenic
1024573257 7:50742886-50742908 CACTTCCTGGGGGCTGGGAAGGG + Intronic
1024637914 7:51305742-51305764 TACTCGATGATGGCTGGGCGTGG + Intronic
1025734486 7:64135013-64135035 AGCTCCATTAGGGATGGGAGAGG - Intronic
1026299962 7:69089330-69089352 CACTCCATGAGGCCTGGGCAGGG + Intergenic
1026996427 7:74619766-74619788 CTCTCCATGGAGGCTGGGCGCGG + Intergenic
1027187982 7:75983048-75983070 AACTGCATTAGGGCTGGGCGAGG + Intronic
1030807940 7:113938819-113938841 GACAACATGCGGGCTGGGAGTGG + Intronic
1032115169 7:129110817-129110839 CACTGCATCAGAGCTGGGGGTGG + Intergenic
1035551422 8:530465-530487 CAGTCCATAAAGACTGGGAGAGG - Intronic
1035958816 8:4113859-4113881 AACTCTATGAAGGCTGAGAGAGG + Intronic
1036060032 8:5306707-5306729 AACTCCAAGAGGGCCGGGCGCGG + Intergenic
1036604870 8:10295800-10295822 GAGTCCATGAGACCTGGGAGAGG - Intronic
1037634962 8:20693333-20693355 CACTCCTTGGGGCCTGGCAGAGG - Intergenic
1037755008 8:21704929-21704951 GACTCCAGGAGGGGTGGGAGGGG + Intronic
1037758969 8:21729405-21729427 CACTCCCTGTGGGCCTGGAGGGG - Intronic
1037801973 8:22040809-22040831 CCCTGCCTGGGGGCTGGGAGTGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038082009 8:24149362-24149384 CACTCCATAAAGACTGGGAGAGG - Intergenic
1039020899 8:33204962-33204984 CACTTCCTGAGGGATGGGGGAGG + Intergenic
1039144990 8:34437673-34437695 GACTGCATGAGGGCTGGAGGAGG + Intergenic
1040509873 8:48084363-48084385 GAGTCCCTGAGGGCTGGGAGTGG + Intergenic
1042851748 8:73223612-73223634 AATTCCATGAGGGCTGAGAGAGG - Intergenic
1045986585 8:108256348-108256370 AACTCCTTGTGGGCTGGGACTGG - Intronic
1046956292 8:120066099-120066121 CATTCAATGAGCGCTGGAAGAGG - Intronic
1047499337 8:125430009-125430031 CACGCCCCCAGGGCTGGGAGGGG - Intergenic
1047681345 8:127257559-127257581 AACTGCAGAAGGGCTGGGAGAGG + Intergenic
1048351215 8:133618255-133618277 AACTCCATGAGGACAGGCAGGGG + Intergenic
1048881306 8:138874892-138874914 GAGTCCATGAGGGCTGAGATTGG - Intronic
1049285835 8:141774763-141774785 CACACCTTGAGTGTTGGGAGGGG + Intergenic
1049499587 8:142954742-142954764 CACTCTATGACGCTTGGGAGCGG + Intergenic
1049540605 8:143207168-143207190 CATTCCTGGAGGGCTGGGTGAGG + Intergenic
1049763089 8:144339579-144339601 CACAACATGGGGCCTGGGAGGGG - Intergenic
1050811339 9:9751731-9751753 CACACCATCAGAGCTAGGAGGGG + Intronic
1051266282 9:15312148-15312170 AATTCCATGAAGGCTGAGAGAGG + Intergenic
1051796611 9:20878936-20878958 CTCTCTATGAGAGCTGGGACAGG - Intronic
1054921076 9:70542745-70542767 CATTCCCTGAGTGCTGGCAGTGG + Intronic
1055273208 9:74585015-74585037 CACTGCATTAGGGCTGAGATTGG - Intronic
1056297613 9:85208105-85208127 TCCTCCATGAGGGGTGGGAATGG + Intergenic
1056478956 9:86981596-86981618 CACTCCATTAGGGTTGGGATGGG - Intergenic
1056698236 9:88878966-88878988 CACTTGGTGAGGGCTGGGTGAGG - Intergenic
1059349508 9:113654494-113654516 AACTCCATGCTGGCTGGGCGTGG - Intergenic
1059361216 9:113743317-113743339 CATTCCAACAGGGGTGGGAGGGG - Intergenic
1059394845 9:114027884-114027906 CTCTCCCTGAGGGCAGGAAGGGG - Intronic
1060117882 9:120959076-120959098 AACTTCATGAGGGCTGGGTGCGG - Intronic
1060208195 9:121694804-121694826 CATTCCCTGACGGCTGGGCGTGG - Intronic
1060743367 9:126113976-126113998 CACTCCAAGAGGGCTGTGTGCGG - Intergenic
1061121525 9:128645988-128646010 AACTCCATGAAGGCTGAGAGAGG + Intronic
1062431275 9:136527823-136527845 GACTCCAGGAGGGCTGCGGGGGG + Intronic
1062555756 9:137112791-137112813 CACTCCAGGTGGGCTGTGATCGG - Exonic
1062581405 9:137230704-137230726 CACTCCAGGAGGGTTGGGCTGGG + Intergenic
1062633279 9:137477026-137477048 CACTCCGTGGGAGATGGGAGGGG + Intronic
1185460896 X:332411-332433 CACCCCGTGAGGGAGGGGAGGGG + Intergenic
1186304052 X:8234928-8234950 AATTCCATGAAGGCTGAGAGAGG - Intergenic
1186826112 X:13341450-13341472 CATTCCAAGGGGGCTGGGCGCGG - Intergenic
1187772282 X:22713213-22713235 CACTGCTGGAGGGCTGGCAGTGG + Intergenic
1187838977 X:23465790-23465812 CAGTCCATAAAGACTGGGAGAGG + Intergenic
1187953558 X:24493867-24493889 AACTCCATGGTGGCTGGGAGTGG - Intronic
1189923125 X:45923127-45923149 CATTCTATGAGGGCTAAGAGAGG + Intergenic
1190193692 X:48298511-48298533 CAGTCCATGAAAGCTGAGAGAGG + Intergenic
1190660211 X:52647141-52647163 CAGTCCATGAAAGCTGAGAGAGG + Intronic
1190966673 X:55307606-55307628 CTCTGCATGGGGACTGGGAGTGG + Intergenic
1191813275 X:65215506-65215528 AACTCTATGAAGGCTGAGAGAGG - Intergenic
1192229675 X:69256331-69256353 TACTCCCTCAGGGCTGGGAAAGG - Intergenic
1192424051 X:71060144-71060166 AACTCCCTGAAGGGTGGGAGTGG - Exonic
1192595705 X:72406134-72406156 ATTTCCATGAGGTCTGGGAGGGG + Intronic
1192632736 X:72789848-72789870 GGCTCCATTAAGGCTGGGAGGGG - Intronic
1192648973 X:72930953-72930975 GGCTCCATTAAGGCTGGGAGGGG + Intronic
1193692126 X:84659028-84659050 GACTCCATGAGGGCCTGGCGGGG + Intergenic
1197987459 X:132281575-132281597 AATTCCATGAAGGCTGTGAGAGG + Intergenic
1198106516 X:133467108-133467130 CATTCCATGCTGGCTGGGTGTGG - Intergenic
1198323102 X:135539369-135539391 AACTCTATGAAGGCTGAGAGAGG - Intronic
1198863114 X:141091886-141091908 TACCCTATGAGGGCCGGGAGGGG + Intergenic
1198899576 X:141495501-141495523 TACCCTATGAGGGCCGGGAGGGG - Intergenic
1199485024 X:148338092-148338114 CACTGCCTGAGGGCTGGGGGAGG - Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic
1200389183 X:155926479-155926501 AACTCTATGAAGGCTGAGAGAGG - Intronic