ID: 1112376816

View in Genome Browser
Species Human (GRCh38)
Location 13:98850307-98850329
Sequence GTTCAAATGCAGCATGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112376816_1112376818 15 Left 1112376816 13:98850307-98850329 CCTTCAACATGCTGCATTTGAAC 0: 1
1: 0
2: 0
3: 7
4: 164
Right 1112376818 13:98850345-98850367 CGTCATTTAGTGCTATATTCTGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112376816 Original CRISPR GTTCAAATGCAGCATGTTGA AGG (reversed) Intronic
900493793 1:2967027-2967049 GTTAGAATGCAGCGTGGTGAGGG + Intergenic
904201982 1:28825823-28825845 GTTCAAATCCAGCTTCTTGCTGG + Intronic
904264837 1:29312313-29312335 GTCCAAATCCTGCATGTTGTTGG + Intronic
904936932 1:34137555-34137577 GTTCAAAGGCAGAAGGGTGAAGG - Intronic
905418938 1:37825598-37825620 GTTCAAATGCATGTTGTTCAAGG - Intronic
907827105 1:58029001-58029023 GATCAAATTAAGCATCTTGAAGG + Intronic
907915505 1:58865286-58865308 ATTCACATGGAGCATGTTCAGGG - Intergenic
911138211 1:94465987-94466009 GAGCAAATCCAGCATGATGAAGG - Intronic
913548468 1:119893577-119893599 GTTCACATGGATCAAGTTGAGGG + Exonic
914338053 1:146734865-146734887 GATCAAATGCAGCATGAAGAAGG - Intergenic
916784747 1:168078429-168078451 GCTCTAGTGCAGGATGTTGATGG + Intergenic
919578021 1:199336623-199336645 GCTCAACTGCAGCTTGTTGGAGG - Intergenic
920169463 1:204061864-204061886 GTGCAAATGGAGCATCTAGAAGG + Intergenic
921442080 1:215199391-215199413 GTTTTATTTCAGCATGTTGATGG - Intronic
921695157 1:218200857-218200879 GTTCAAATGCAGCTGGTTTCAGG + Intergenic
924812432 1:247415275-247415297 GGTCAAATGCAGTATAATGAAGG + Intergenic
1064260721 10:13784027-13784049 GTTGAAATGCAACATCTTGGAGG + Intronic
1064874203 10:19974875-19974897 TCTCAAAGGCAGCTTGTTGAAGG + Intronic
1068105997 10:52617169-52617191 TTTCAAAAGCACCATTTTGAAGG - Intergenic
1069055229 10:63838021-63838043 GTTCCATTGCAGCATTTTCAGGG - Intergenic
1072428495 10:95350905-95350927 GATAAAATGCAGGATGTGGAGGG + Intronic
1075391336 10:122094744-122094766 GTTCAAGTGCAGCATGAACAGGG - Intronic
1081319987 11:41680073-41680095 CTTAAAATGCAGAATGGTGAAGG + Intergenic
1083797443 11:65025383-65025405 GTTGAAATGCAGCATGAAGTTGG - Intronic
1087194722 11:95293761-95293783 GGTGAGATGCAGCATGTTCAGGG + Intergenic
1087399837 11:97651561-97651583 GGTCAACTGCAGCTTGTTAAGGG + Intergenic
1089905611 11:122035147-122035169 GTTCAACTGAAGAAGGTTGAAGG + Intergenic
1091838221 12:3600953-3600975 CTGGAAATGCAGCATGGTGAGGG - Intergenic
1095304453 12:40623264-40623286 ATTCAAATGTAGAATGTTAAAGG - Intergenic
1095745003 12:45648276-45648298 GTTGGACTGCAGCCTGTTGATGG + Intergenic
1098553344 12:71790204-71790226 TTTCAAATGCATCATATTAAAGG + Exonic
1099390527 12:82073446-82073468 CTTCAACAGCAGCAAGTTGATGG + Intergenic
1100209085 12:92382648-92382670 GTTTAAATGCTGCATTTTCAGGG + Intergenic
1102474517 12:113179967-113179989 GTTCAAAGGCATCATGAAGAAGG - Exonic
1105590241 13:21785855-21785877 ATTATAATTCAGCATGTTGAGGG + Intergenic
1106033728 13:26025404-26025426 GTTCAAATGCATCATCTTTGTGG + Exonic
1108255114 13:48602373-48602395 TTTCAGATGCAGCATGTCCAGGG - Intergenic
1109288840 13:60447835-60447857 GTTAAAAAGCAACATGTTGCGGG + Intronic
1111651788 13:91100170-91100192 TTTCAAATACATCATTTTGAAGG - Intergenic
1112376816 13:98850307-98850329 GTTCAAATGCAGCATGTTGAAGG - Intronic
1113892331 13:113743032-113743054 GTTCAAAAGAAGCTCGTTGAGGG - Intergenic
1119207686 14:72806884-72806906 GTTGAAATGCAGCAAGATCAGGG + Intronic
1121943789 14:98098931-98098953 ATTCAAATGATGCATGTTGGAGG + Intergenic
1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG + Intergenic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1125814387 15:42572036-42572058 GTTCTAATCAATCATGTTGAAGG - Intergenic
1128439166 15:67687910-67687932 GTAGAAATGGAGCGTGTTGATGG + Intronic
1129094517 15:73189417-73189439 GTTCAAAACCGGCTTGTTGAAGG + Intronic
1137943006 16:52707382-52707404 GTTATAATGAAGCATGATGAGGG - Intergenic
1139996226 16:70982475-70982497 GATCAAATGCAGCATGAAGAAGG + Intronic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143700285 17:8654409-8654431 GTTAAAATGCAGTATTTTCAGGG - Intergenic
1144848609 17:18232872-18232894 GTGCAAAGGCAGCATGGAGATGG + Intronic
1146082305 17:29791472-29791494 GTTCAAATGTAGCTTGTAGTAGG - Intronic
1146751884 17:35389389-35389411 GGTCAACTGCTGCTTGTTGAAGG + Intergenic
1149896190 17:60430281-60430303 GTTCAAATGAAACATGTTTTTGG + Intronic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1157821296 18:50772231-50772253 GTTCAAGGGCAGGATGTTCAAGG + Intergenic
1158406417 18:57163867-57163889 GTTCAAATTCTGCATGCTCAGGG + Intergenic
1159730078 18:72015070-72015092 CTTCAAATGAAACATGTAGATGG - Intergenic
1164734763 19:30532661-30532683 GGGCAAATGCAGCATGCTCAGGG + Intronic
1167484135 19:49750776-49750798 CTTCAAATGCAGCAGGTTACAGG - Intronic
1168459867 19:56545537-56545559 AGTCAGATGCAGCATGGTGAGGG + Intronic
925423097 2:3727450-3727472 TTGCAGCTGCAGCATGTTGAAGG + Intronic
926363518 2:12112359-12112381 GTTCCATTGCAGCATTGTGATGG + Intergenic
928865492 2:35912922-35912944 GTTCCAATGCAGCAGGTGGGTGG + Intergenic
929643977 2:43609242-43609264 GTTCAAATGGAGCAAGTGGTTGG + Intergenic
930229461 2:48828134-48828156 GGTCAAATGCACCTTGTTGGAGG - Intergenic
930644853 2:53894962-53894984 GTTCAAATGCATCTTGTTTTGGG - Intronic
931883817 2:66594021-66594043 GTTCAAAAGCAGCATTTTATGGG - Intergenic
933232626 2:79826705-79826727 GTTGAAATGAAGGAAGTTGAAGG - Intronic
933945518 2:87283075-87283097 GTTGAAATGAAGGATGTTGCCGG - Intergenic
935649890 2:105373204-105373226 GTACAAATTCAGCAGGTAGAAGG + Intronic
935934938 2:108171526-108171548 GATGAAATGCTTCATGTTGATGG - Intergenic
936334692 2:111578514-111578536 GTTGAAATGAAGGATGTTGCCGG + Intergenic
937255654 2:120553631-120553653 GCTCAATTGCTACATGTTGAAGG - Intergenic
937569056 2:123334142-123334164 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
938276604 2:130031223-130031245 ATTCAAATGAAAAATGTTGAAGG + Intergenic
938438769 2:131306129-131306151 ATTCAAATGAAAAATGTTGAAGG - Intronic
939724636 2:145701500-145701522 GGTTCAATGCAGCATGTTCATGG - Intergenic
942171333 2:173292205-173292227 GTGCAAATCCTGCATGGTGATGG - Intergenic
944442057 2:199752612-199752634 GTCCAAATTCTGCAGGTTGAGGG - Intergenic
946536084 2:220630313-220630335 TTTCAAATGAAGCCTGTTGTTGG - Intergenic
946818643 2:223607951-223607973 GTTAAAGTGCAGCATCTTTATGG + Intergenic
1169399262 20:5265871-5265893 GTTCACATGTAGGATGTAGACGG + Intergenic
1171020359 20:21579243-21579265 TTTTCCATGCAGCATGTTGAAGG + Intergenic
1175002809 20:55648102-55648124 GTTCAAATGTGGCATTGTGAAGG + Intergenic
1182412479 22:30198957-30198979 GTGCAAATCCATCCTGTTGAAGG + Intergenic
1184702854 22:46188483-46188505 TTGCAAAGGCAGCATGATGAGGG - Intronic
949134749 3:550700-550722 GATGAAATACAGAATGTTGATGG + Intergenic
951473688 3:23082346-23082368 GTTCAAATGCAGAAGGTCCATGG + Intergenic
952971468 3:38653443-38653465 GCTCAAAAGCAGGGTGTTGAGGG - Intergenic
960165262 3:114394358-114394380 GTTCCAATGCAGCATGGACACGG + Intronic
960857058 3:122112631-122112653 TTACAAATTCAGCATTTTGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963387673 3:144617758-144617780 CATCTAATGCAGCATGTAGAGGG - Intergenic
963690256 3:148490664-148490686 CTTCAAATGCAGCAACTAGATGG + Intergenic
964049864 3:152377596-152377618 GTTCAAAGGCAAATTGTTGATGG + Intronic
964255645 3:154772080-154772102 GGTCAACTGCAGCTTGTTGGAGG + Intergenic
965314309 3:167172234-167172256 GTTAAAATGCAGGCTGATGATGG - Intergenic
970326842 4:14934613-14934635 GTTCAAATGCACGTTGTTCAAGG + Intergenic
971003847 4:22352045-22352067 GGTCAACTGCAGCTTGTTGAAGG - Intronic
971524022 4:27592982-27593004 GTGCAAATAAACCATGTTGATGG - Intergenic
972376092 4:38471818-38471840 TTTCAAATCCAACATGTTAAAGG - Intergenic
974282251 4:59812423-59812445 ATTCAAATCCACCATATTGAAGG + Intergenic
974807754 4:66902165-66902187 GTTCAAATGCAACAATTTTAAGG + Intergenic
977394096 4:96450419-96450441 GGTCAACTGCAGCTTGTTGGGGG + Intergenic
977649517 4:99453948-99453970 GGTCAATTGCAGCTTGTTGGAGG + Intergenic
978208253 4:106105149-106105171 GTTCAACTGCAGCTTGTTGGAGG - Intronic
981529249 4:145735974-145735996 GTTCCAGTGAAGCATGTTTATGG + Intronic
985803837 5:2024184-2024206 GATCAAATTCAGCAGCTTGAAGG - Intergenic
988250408 5:28750091-28750113 GTTAAAATTCAGCATTTTGAAGG + Intergenic
988996483 5:36719895-36719917 ATTCAGATGCAGCTGGTTGAAGG - Intergenic
990172799 5:53073357-53073379 GTTCAGATTGATCATGTTGAGGG - Intronic
990659008 5:57991624-57991646 TTTCTAATGCAGCCTTTTGAAGG - Intergenic
990878738 5:60517297-60517319 GTGCCAGTGCAGCAGGTTGATGG + Intronic
994908861 5:105875355-105875377 TTTGAAATCCAGCATGTTTAGGG + Intergenic
995187844 5:109290343-109290365 GGCCAACTGCAGCTTGTTGAAGG - Intergenic
995428685 5:112050668-112050690 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
996117688 5:119635548-119635570 GATCAAATGCAGCAAAATGAAGG - Intronic
996699416 5:126435399-126435421 GTTCAAATGCATGTTTTTGATGG + Intronic
998736505 5:145147582-145147604 GTTCACATGCAATATATTGATGG - Intergenic
999052184 5:148534630-148534652 GGTCAAGTGCAGCTTGTTGGAGG - Intronic
1000450068 5:161374459-161374481 GTGCCAATGCAGTATGCTGATGG - Intronic
1000615414 5:163420421-163420443 GTTCAAAAACAGCATGAAGAAGG + Intergenic
1002512244 5:179728758-179728780 GTTCAACTGGAGCCTGCTGATGG - Exonic
1005213531 6:23497572-23497594 GTCTAAATGAAGCATGTGGAAGG + Intergenic
1008173248 6:48234766-48234788 GGTCAACTGCAGCTTGCTGAAGG - Intergenic
1008973883 6:57401857-57401879 GCTCAACTGCAGCTTGTTGGAGG + Intronic
1009162773 6:60303362-60303384 GCTCAACTGCAGCTTGTTGGAGG + Intergenic
1010873560 6:81071563-81071585 GTGCAATGGAAGCATGTTGAAGG - Intergenic
1013306441 6:108851064-108851086 GATCAAATACAACATTTTGAGGG - Intronic
1017957611 6:159191793-159191815 GTTAAAATGGAGCATATTCAAGG + Intronic
1019608834 7:1925259-1925281 GTTCAATTTCATTATGTTGAGGG - Intronic
1020702351 7:11499132-11499154 GGTCAACTGCAGCTTGTTGGAGG - Intronic
1020843646 7:13254862-13254884 GTTCAAATCCATATTGTTGAAGG - Intergenic
1021283507 7:18749840-18749862 ATTCAAATGCAGAATGTTACTGG - Intronic
1023191076 7:37583801-37583823 CTTCAAATGCAGCAACTAGATGG + Intergenic
1027679927 7:81207263-81207285 GTGCAAAAACAGCATGTTCAAGG + Intergenic
1028077426 7:86533868-86533890 GGGCAACTGCAGCTTGTTGAAGG + Intergenic
1028363348 7:89995733-89995755 GTTAAAATGAAGCATTTTGGCGG - Intergenic
1029052195 7:97700738-97700760 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
1030685111 7:112478246-112478268 ATTCAAATTCAGAATTTTGAAGG + Intronic
1031673229 7:124577828-124577850 GGTCAAATCCACCATGTTTATGG - Intergenic
1038900256 8:31834081-31834103 GTTTAAATCCAGCTTGTTCATGG - Intronic
1039906893 8:41793016-41793038 GTCCAAGTGCAGCCTGTTGAAGG + Intronic
1044125929 8:88457755-88457777 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
1044481506 8:92695328-92695350 GTACAAATGCAGCACATTGGAGG - Intergenic
1045378000 8:101594258-101594280 GTTCAAAGCCACCATGTTTATGG + Intronic
1046185992 8:110719212-110719234 GTTAAAATGCATCAGGTTTAGGG - Intergenic
1048230518 8:132635994-132636016 GTTCAAGTTCAAGATGTTGACGG - Intronic
1048647163 8:136434871-136434893 GTGCAAATGGAGCATGGTGTAGG + Intergenic
1050153571 9:2642134-2642156 AATAAAATGCTGCATGTTGAAGG + Intronic
1051917641 9:22227074-22227096 GTTAAAATTCAGCTTATTGATGG + Intergenic
1052311595 9:27074636-27074658 GGTCAACTGCAGCTTGTTGGAGG + Intergenic
1052767017 9:32651282-32651304 GGTCAATTGCAGCTTGTTGGAGG - Intergenic
1053227689 9:36374989-36375011 GTGCATATCCAGGATGTTGAAGG - Intronic
1053275826 9:36782571-36782593 GTCAGAATGCAACATGTTGAAGG - Intergenic
1055252298 9:74322452-74322474 GTTAAAATGTAGCAATTTGAAGG - Intergenic
1060701369 9:125752102-125752124 GTTAAAATACTCCATGTTGATGG + Intronic
1061730660 9:132611432-132611454 TTACAAATGTAGCATGCTGAGGG + Intronic
1192926428 X:75759404-75759426 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
1193005972 X:76618370-76618392 GGTCAATTGCAGCTTGTTGGAGG - Intergenic
1193739652 X:85202800-85202822 GGTCAACTGCAGCTTGTTGGAGG + Intergenic
1194712014 X:97246592-97246614 ATACAAATTCATCATGTTGATGG - Intronic
1194803450 X:98299680-98299702 GTTCAAATGTATCATATTCAAGG - Intergenic
1196305556 X:114098261-114098283 GTTCTAATTCAGCATGTAGCTGG - Intergenic
1196932642 X:120696536-120696558 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
1197402404 X:126007265-126007287 GGTCAACTGCAGCTTGTTGGAGG - Intergenic
1197414940 X:126164453-126164475 GCACAAATGCAGCATGAAGAAGG + Intergenic
1198180738 X:134206105-134206127 GTTCAAATGCAGTAACTTGAAGG + Intergenic
1199306995 X:146278968-146278990 GGTCAACTGCAGCTTGTTGGAGG + Intergenic