ID: 1112377824

View in Genome Browser
Species Human (GRCh38)
Location 13:98860404-98860426
Sequence CTGGGCGCCATCTCCGGCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112377824_1112377832 6 Left 1112377824 13:98860404-98860426 CCAATGCCGGAGATGGCGCCCAG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1112377832 13:98860433-98860455 CTTGTGCAGGCTGTTGTCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 227
1112377824_1112377831 5 Left 1112377824 13:98860404-98860426 CCAATGCCGGAGATGGCGCCCAG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1112377831 13:98860432-98860454 CCTTGTGCAGGCTGTTGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 231
1112377824_1112377827 -7 Left 1112377824 13:98860404-98860426 CCAATGCCGGAGATGGCGCCCAG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1112377827 13:98860420-98860442 CGCCCAGCAGGTCCTTGTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1112377824_1112377833 22 Left 1112377824 13:98860404-98860426 CCAATGCCGGAGATGGCGCCCAG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1112377833 13:98860449-98860471 TCCAGGGTGCTTCCCTTCTGCGG 0: 1
1: 0
2: 5
3: 19
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112377824 Original CRISPR CTGGGCGCCATCTCCGGCAT TGG (reversed) Exonic