ID: 1112380341

View in Genome Browser
Species Human (GRCh38)
Location 13:98882918-98882940
Sequence GCTACTGATGTGAGACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112380339_1112380341 -1 Left 1112380339 13:98882896-98882918 CCACTATCTAAACCTCATAGAAG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112380338_1112380341 9 Left 1112380338 13:98882886-98882908 CCACTTCTTACCACTATCTAAAC 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112380337_1112380341 16 Left 1112380337 13:98882879-98882901 CCTAGGTCCACTTCTTACCACTA 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112380336_1112380341 21 Left 1112380336 13:98882874-98882896 CCGTTCCTAGGTCCACTTCTTAC 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112380341 Original CRISPR GCTACTGATGTGAGACATCC AGG Intronic
908373935 1:63514186-63514208 TCTACTGATGTGCAACAACCTGG - Intronic
915202192 1:154239321-154239343 GCTCCTGGTATGATACATCCAGG + Intronic
920603678 1:207357519-207357541 GCTACTGCTTTGAGACTCCCTGG + Intronic
921154278 1:212426606-212426628 GCAACTGCTCTGAGACATCTGGG - Intergenic
921594180 1:217037268-217037290 GCTGCTGATGAAAGACATACTGG + Intronic
1064316269 10:14260656-14260678 TCTACTGATGGGAGATAGCCAGG - Intronic
1066242104 10:33548011-33548033 ACTACGCATGTGAGGCATCCAGG - Intergenic
1066514567 10:36143105-36143127 GCTTCAGATCTGGGACATCCAGG - Intergenic
1068588454 10:58827621-58827643 GCAACTGATGTTAGACAGTCTGG + Intronic
1071789934 10:88942698-88942720 GCAAATGATGTCAGACATTCTGG - Intronic
1072236551 10:93458787-93458809 GCCACTAATGTGAGACTGCCTGG - Intronic
1075559156 10:123456097-123456119 GCTTCTTGTGTTAGACATCCTGG - Intergenic
1079076940 11:17389904-17389926 GCTACTGCTGTGGGGCAGCCTGG + Intergenic
1083588307 11:63876586-63876608 TCTACTGATGAGAGGTATCCTGG + Intronic
1087534136 11:99422715-99422737 TCTTCTTAAGTGAGACATCCTGG + Intronic
1089129513 11:116200845-116200867 GCTACTGCTCTGAGACATTTAGG - Intergenic
1090077579 11:123589075-123589097 GCTGCTCATGTGACACATTCCGG - Intronic
1090861917 11:130661635-130661657 GCTGCTGAGGTGTGACATTCAGG + Intergenic
1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG + Intergenic
1098636805 12:72793916-72793938 GCTTCTGATGCCAGATATCCAGG - Intergenic
1103931682 12:124453960-124453982 GCTTCTGATGGAAGACACCCTGG + Intronic
1107711615 13:43156140-43156162 GTGACTGGTGTGAGCCATCCAGG - Intergenic
1108085866 13:46792530-46792552 GCTTCTGATGTCAGACTTCTGGG - Intronic
1110737396 13:78953276-78953298 GATACTGACATGAGACAGCCAGG - Intergenic
1110737871 13:78959608-78959630 GATACTTATGTAAGACATCATGG + Intergenic
1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG + Intronic
1116071707 14:40055149-40055171 GCTACTGTTGTGGGATGTCCTGG + Intergenic
1117737211 14:58780169-58780191 GATACTGCTGTCAGACTTCCTGG - Intergenic
1122985662 14:105210536-105210558 GCTACTGAAGTGTGGCCTCCAGG - Exonic
1132267084 15:100483730-100483752 GCCAATGATGTGAGACAGTCAGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133523081 16:6577690-6577712 ACTACCACTGTGAGACATCCAGG - Intronic
1138638584 16:58364251-58364273 ACTGCTGATGTGCAACATCCAGG - Intronic
1143185340 17:5006849-5006871 GGAGCTGATGAGAGACATCCAGG - Intronic
1144066558 17:11629625-11629647 CCTACAGATGAGAGGCATCCGGG - Intronic
1149523072 17:57333082-57333104 GCCACTAAAGTGAGACAGCCAGG - Intronic
1150799990 17:68273605-68273627 GACACTGATGTGAGAAATACTGG + Intronic
1160230455 18:77044546-77044568 GCGAGTGATGTGAGACAGCGAGG - Intronic
1161799600 19:6409496-6409518 GACACTGATGTGAGATATTCTGG - Intergenic
1164386371 19:27773955-27773977 GCTGCTGATGAGAGCCATCTGGG - Intergenic
1166560199 19:43727722-43727744 GCTACTGTTGACAGCCATCCAGG - Intergenic
931132572 2:59353688-59353710 GCAGCTGATGTGAAACATTCTGG + Intergenic
938578471 2:132625231-132625253 ACTCCTGATGAGGGACATCCTGG + Intronic
1172037749 20:32021685-32021707 GCTTCTTATCTGAGTCATCCTGG + Intronic
1173237527 20:41261097-41261119 GCTAATGATGTGTGAGACCCTGG - Intronic
1175349151 20:58306349-58306371 GCTACAGGTGTGAGAGAGCCAGG + Intergenic
1179119930 21:38534377-38534399 GCTTCTGATGTGTGACTTTCAGG - Intronic
1182265354 22:29110536-29110558 ACTACTGCTGTGATAGATCCTGG + Intronic
1184250796 22:43259048-43259070 GCTGATGTTGTGAAACATCCTGG - Intronic
949768749 3:7555014-7555036 GATACTGAAGTCAGACAGCCAGG + Intronic
959386622 3:105716806-105716828 GCTACTGAAGTGTGACTTCTAGG + Intronic
960748895 3:120924141-120924163 GATAATGATGTGAAACATACTGG - Intronic
970625605 4:17875598-17875620 ACTTCTGATATGAGACATTCTGG + Intronic
971233334 4:24818635-24818657 GCCACTGGAGTGAGCCATCCTGG - Intronic
974928208 4:68327553-68327575 GCTACTGATGTAAGTGATCCAGG + Intronic
975844578 4:78511474-78511496 GCTCCTTATGTTTGACATCCAGG - Intronic
986856817 5:11878896-11878918 GTTATTAATTTGAGACATCCAGG - Intronic
996566422 5:124883906-124883928 GCTAAACATGTGAGACATCTGGG + Intergenic
1011516250 6:88156944-88156966 GATACTGAAATAAGACATCCTGG - Intronic
1013614524 6:111829487-111829509 GCTCCTGATGTGAGAGACCTGGG - Intronic
1013867788 6:114720110-114720132 GCTACTGATGAGAGAAAAACAGG + Intergenic
1019486731 7:1292851-1292873 GCCCCTGACGTGAGACATCCTGG - Intergenic
1037353352 8:17989476-17989498 TTTTCTGATGTGAGACAACCAGG + Intronic
1038490271 8:27965627-27965649 GGTACTCATGTGAGACATGTTGG + Intronic
1039263466 8:35798660-35798682 GCTTCTGAATAGAGACATCCTGG + Intergenic
1041904869 8:63021465-63021487 GCACCTGCTGTGCGACATCCTGG + Intronic
1046912323 8:119642006-119642028 CCTCCTGATTTCAGACATCCAGG + Intronic
1055512613 9:77010460-77010482 GCTACTCATGTGAGCTAGCCTGG - Intergenic
1058912537 9:109534193-109534215 GCTGCTGATGTGAAGCCTCCCGG + Intergenic
1059473530 9:114525399-114525421 ACTACTGATGGGAAACTTCCTGG - Intergenic
1187221730 X:17333420-17333442 GTTACAGCTGTGAGATATCCAGG - Intergenic
1187586128 X:20663808-20663830 GCTAATGATGTTAAACATCTTGG - Intergenic
1189067056 X:37821250-37821272 GCTACTTCTGTGACACATCTGGG - Intronic
1192804812 X:74499270-74499292 GCAACTGATAAGAGACATCAAGG - Intronic
1197391353 X:125869716-125869738 GCTATTCCTGTGAGACATCCAGG - Intergenic
1198173308 X:134129372-134129394 TCTAGTGATCTGAGACATACTGG + Intergenic