ID: 1112381306

View in Genome Browser
Species Human (GRCh38)
Location 13:98893174-98893196
Sequence CAGTGTAACCAGAGCGAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112381301_1112381306 23 Left 1112381301 13:98893128-98893150 CCCAGTGGGTTTAGAGAAAGTCA 0: 1
1: 0
2: 1
3: 27
4: 186
Right 1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG 0: 1
1: 0
2: 1
3: 10
4: 68
1112381305_1112381306 -6 Left 1112381305 13:98893157-98893179 CCTACTTGGCTTGAGTGCAGTGT 0: 1
1: 0
2: 0
3: 32
4: 600
Right 1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG 0: 1
1: 0
2: 1
3: 10
4: 68
1112381304_1112381306 -5 Left 1112381304 13:98893156-98893178 CCCTACTTGGCTTGAGTGCAGTG 0: 1
1: 0
2: 2
3: 19
4: 248
Right 1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG 0: 1
1: 0
2: 1
3: 10
4: 68
1112381302_1112381306 22 Left 1112381302 13:98893129-98893151 CCAGTGGGTTTAGAGAAAGTCAA 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG 0: 1
1: 0
2: 1
3: 10
4: 68
1112381300_1112381306 24 Left 1112381300 13:98893127-98893149 CCCCAGTGGGTTTAGAGAAAGTC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG 0: 1
1: 0
2: 1
3: 10
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112381306 Original CRISPR CAGTGTAACCAGAGCGAAAT CGG Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
909093987 1:71264158-71264180 CAGTGTACCCTGAGAAAAATCGG - Intergenic
909537017 1:76748348-76748370 CAGTGTAACCATATAGAAATGGG + Intergenic
910267773 1:85357769-85357791 CAGTATAACCAGAATGAATTTGG + Intronic
910354701 1:86341448-86341470 CAGTTAAACCAGAGAGAAAAAGG - Intergenic
915629944 1:157145435-157145457 CAGTGTTAACAGAGCAATATGGG + Intergenic
919402367 1:197135402-197135424 AAATGTAATCAGAGCAAAATGGG + Intronic
919962945 1:202490639-202490661 CAGCGTTGCCAGAGGGAAATGGG - Intronic
923332925 1:232942480-232942502 CACAGTATCCAGAGCAAAATAGG + Intergenic
1065313351 10:24437541-24437563 CAGTGTAGACAGAGCCAAAAGGG + Intronic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1067982501 10:51102541-51102563 CAGTGTAACAGGAGCCGAATGGG - Intronic
1071853360 10:89598546-89598568 CAGTGTAAACAAAACTAAATAGG - Intronic
1078462080 11:11521842-11521864 CAGGGCAGCCAGAGCCAAATGGG + Intronic
1081806342 11:45892869-45892891 TAGAGGAACCAGAGGGAAATGGG + Intronic
1082108514 11:48245804-48245826 CAAGATAACCACAGCGAAATGGG - Exonic
1085397649 11:76214993-76215015 CATTGTAACCAATGAGAAATGGG - Intergenic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1093492792 12:19724496-19724518 CAGTATACCCAGAGTGCAATAGG - Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1099701227 12:86084903-86084925 CAGTGTAACCTGAGTAGAATAGG + Intronic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1112381306 13:98893174-98893196 CAGTGTAACCAGAGCGAAATCGG + Intronic
1114334110 14:21670177-21670199 CAGTGTAACTACAGTGAGATGGG + Intergenic
1115480646 14:33857906-33857928 AAGTGGAACCAGAGCGTAATGGG - Intergenic
1122187779 14:100014805-100014827 AAGTGAAACCAGGGAGAAATGGG + Intronic
1127817420 15:62623740-62623762 CAGTAAAACCAAAGGGAAATAGG - Intronic
1128664914 15:69531020-69531042 CAGGGTAAACTGAGGGAAATGGG - Intergenic
1130789760 15:87141463-87141485 TAGTGTAACCTGAGAGAAATAGG + Intergenic
1132253614 15:100354207-100354229 CAGTGAATCCAGAGAGAGATGGG - Intergenic
1148964444 17:51422874-51422896 CAGTGTTACCAGAGCCTGATAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156533761 18:37843360-37843382 CAGAGGAAACAGAGCAAAATAGG + Intergenic
1165460855 19:35943603-35943625 TAGGGGAACCAGAGGGAAATTGG + Intronic
927454632 2:23239001-23239023 AAGTGTAACCAGAGTTTAATTGG - Intergenic
929241665 2:39659779-39659801 CAGTGGAAACAGAGAGAAATGGG - Intergenic
931888116 2:66640650-66640672 CAGGGTCACCAGTGCTAAATGGG + Intergenic
931912385 2:66914809-66914831 GAGTGTAAACAGAATGAAATTGG + Intergenic
932106291 2:68945752-68945774 CAGAGCAACCAGAGTGAAAGAGG - Intronic
937548441 2:123055004-123055026 CACTGTTACAAGAGAGAAATAGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947277426 2:228408496-228408518 CAGTGTATCCAGAGTAAATTAGG + Intergenic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
1169005590 20:2204626-2204648 CAGTCTAATCAGAGCGATATAGG - Intergenic
1173006849 20:39146464-39146486 CACTGTAAAAAGAGCTAAATGGG - Intergenic
1176427015 21:6554230-6554252 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1179702506 21:43162552-43162574 CTGTGAAACCAGAGCGAAAACGG - Intergenic
950168748 3:10821467-10821489 AAGTGTAACCAGAGGAAAATGGG + Intronic
963291057 3:143489716-143489738 CAGTGTAAACAGAGTAAAAAAGG + Intronic
963505161 3:146175804-146175826 GAGTGGATCCAGAGCAAAATTGG - Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
978943901 4:114471864-114471886 AAATGTTACCAGAGTGAAATTGG - Intergenic
984855004 4:184187449-184187471 CAGTGTAGCAAGAGCAAAAAAGG - Intronic
986421949 5:7594133-7594155 CACTGTAACCAGTGCCAGATTGG - Intronic
988499057 5:31768869-31768891 CAGTATTACCACAGCGAAGTTGG - Intronic
990748544 5:58986092-58986114 CTGTGTGACCACAGCGACATAGG - Intronic
996813861 5:127551856-127551878 CAGTGCAGCCAGAGCGATAGCGG + Exonic
996842030 5:127857494-127857516 CATTGAAACCAGAGCGTATTAGG + Intergenic
1007867518 6:44989188-44989210 CAGTGTAACCAAAGGGTGATGGG - Intronic
1010411916 6:75570337-75570359 AAGCGTAGCCAGAGAGAAATGGG + Intergenic
1011399848 6:86948650-86948672 CAGTGTGACCTGAACGATATGGG - Intronic
1011477699 6:87764024-87764046 CATGGAAACCAGAGGGAAATGGG + Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1022663193 7:32385733-32385755 CAGGGGAACCAGAGAGAATTTGG + Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1025067963 7:55874170-55874192 CATTGTTACCAGAGCGTAATTGG + Intergenic
1030448444 7:109677359-109677381 TAATGTAACCATAGTGAAATGGG - Intergenic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1042624774 8:70745704-70745726 CAATGGAACCACAGAGAAATTGG + Intronic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1051822950 9:21190495-21190517 CAGTGAAAACAGAGCTAAAGGGG + Intergenic
1051824773 9:21209030-21209052 CAGTGAAAACAGAGCTAAAGGGG + Intronic
1051826272 9:21223808-21223830 CAGTGAAAACAGAGCTAAAAAGG + Intronic
1054977069 9:71160077-71160099 CAGTATAACTAGAGCTGAATAGG - Intronic
1189024894 X:37383663-37383685 CAATTCAACCAGAGAGAAATAGG - Intronic
1193438692 X:81512474-81512496 CAGTTTAGCCAGAGCAGAATTGG + Intergenic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic