ID: 1112381800

View in Genome Browser
Species Human (GRCh38)
Location 13:98897910-98897932
Sequence CCCAACCACATGCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112381800 Original CRISPR CCCAACCACATGCCTCCAGC TGG (reversed) Intronic
902550041 1:17213929-17213951 ACCAACCTCATGCCCACAGCAGG - Intronic
903641065 1:24860853-24860875 CCCCGCCCCATGCCTCCACCTGG - Intergenic
904561728 1:31402779-31402801 CCTAACTACAAGCTTCCAGCTGG - Intergenic
905302227 1:36993206-36993228 CCCAGCCTCCTGACTCCAGCTGG - Intronic
905392176 1:37643716-37643738 CCCAGCCACATGCCCTCAGAAGG + Intergenic
905907329 1:41627738-41627760 CCCAAACACAGGCCCCCAGAAGG + Intronic
906965776 1:50455046-50455068 CCCAGCCTCATTCCTACAGCAGG + Intronic
909564419 1:77039109-77039131 CCCACCCACCTGCCTCCCACTGG + Intronic
911248123 1:95542426-95542448 GTCAACTACATGCCTGCAGCTGG - Intergenic
913187283 1:116380425-116380447 CCCAAACACCAGCCTCCAACAGG - Intronic
915598941 1:156910398-156910420 CCCTTCCACCTGCCACCAGCAGG + Intronic
920831465 1:209469479-209469501 CCCACCCAAATGGCCCCAGCTGG - Intergenic
921253228 1:213316868-213316890 ACCAAGCACATGCCTACTGCAGG - Intergenic
922243318 1:223771218-223771240 CACAAACACATGCCACCAACAGG + Intronic
924012866 1:239685177-239685199 CCCAGCCACAGAACTCCAGCCGG + Intronic
924831938 1:247605574-247605596 CCCAATCCCATCCCTCCAGGGGG - Exonic
1064041038 10:11964056-11964078 ACCGTCCACATGTCTCCAGCAGG + Exonic
1064159261 10:12929667-12929689 CCCTTCCACATGGGTCCAGCAGG + Intronic
1065328279 10:24569429-24569451 CCCACCCAAATTGCTCCAGCCGG + Intergenic
1066037524 10:31508516-31508538 CCCAACCTCAGGCCTCCAGGAGG + Intronic
1067459882 10:46450462-46450484 CCCACCCACATACCTGCAGCAGG - Intergenic
1067627305 10:47934151-47934173 CCCACCCACATACCTGCAGCAGG + Intergenic
1069093410 10:64229407-64229429 CCGAACCCCATGCCTCCTGATGG - Intergenic
1069592285 10:69649704-69649726 CCCCACCAGGTGCCTTCAGCTGG + Intergenic
1069989979 10:72309263-72309285 CCAAACCTCATTCCCCCAGCAGG - Intergenic
1070688992 10:78510853-78510875 CCCCATCACATGCCACCAGCGGG + Intergenic
1071037740 10:81267406-81267428 CCCACCCAAATGTCTCCGGCCGG + Intergenic
1071384634 10:85106923-85106945 CCCATCCACATGCCTCAAAAGGG - Intergenic
1071520828 10:86330582-86330604 CCCAACCACAGGCTGCCATCAGG + Intronic
1075072024 10:119326043-119326065 CCCAACATCTAGCCTCCAGCTGG + Intronic
1076526002 10:131112718-131112740 TCCAAACAAATGCCTGCAGCCGG - Intronic
1077225510 11:1437578-1437600 CCCATCCACAGGCTCCCAGCTGG - Intronic
1077230764 11:1457328-1457350 CCCAGGGTCATGCCTCCAGCAGG + Intronic
1078290384 11:10005000-10005022 CCCACCCCCATGCCACCACCAGG + Intronic
1081889574 11:46529482-46529504 CCCTACCACTTGGCTCCACCAGG - Intronic
1082894919 11:58179863-58179885 CCCAGCCACAAGACTCAAGCGGG - Exonic
1083641534 11:64148308-64148330 CCCCTCCACATCCCTGCAGCTGG + Intronic
1083960582 11:66012807-66012829 CCCTACCCTATGCCCCCAGCTGG + Exonic
1085314223 11:75534597-75534619 CCCACCCGAATGGCTCCAGCTGG + Intergenic
1085516097 11:77112805-77112827 CCCACCCACCTGCCTGCTGCTGG - Intronic
1086123486 11:83326238-83326260 CCCAACTTCAGGCCCCCAGCAGG + Intergenic
1086335002 11:85791738-85791760 GCTAACCACATGACTCCATCTGG - Intronic
1087014035 11:93538998-93539020 CCAAAGCCCATGCTTCCAGCTGG - Intronic
1087196106 11:95305655-95305677 CACACACACAAGCCTCCAGCTGG - Intergenic
1087841191 11:102922703-102922725 CCAAACTACATGACTCCAGCAGG + Intergenic
1088714219 11:112534730-112534752 CCCAACCACATGCAGCAAGCAGG - Intergenic
1089690767 11:120185453-120185475 TCCCACCACCTGCCTCCTGCGGG - Intronic
1089950859 11:122524812-122524834 CCCAACCATATGCTTCCATTTGG + Intergenic
1090654944 11:128835968-128835990 CCCAGCCAGATGCACCCAGCTGG - Intergenic
1091232852 11:133999713-133999735 CTCAGCCACCTGCCTACAGCCGG + Intergenic
1091593218 12:1857670-1857692 TCCAACCCCATCCCTCCTGCCGG - Intronic
1096614028 12:52821634-52821656 CCCAAGCACATCACTCAAGCTGG + Exonic
1096956813 12:55534613-55534635 CCCAGTCACACGCCTCCACCTGG + Intergenic
1100587444 12:95993245-95993267 ACCAACCCCATCCCTCCACCTGG + Intronic
1101269856 12:103132147-103132169 GCCTACCAGATGCCTCTAGCTGG - Intergenic
1103453056 12:121043160-121043182 CCCCACCACATATCTCCACCTGG - Intergenic
1104979293 12:132566559-132566581 CTCAACCACCTGCCACAAGCAGG - Intronic
1105854407 13:24361791-24361813 CCCATCCACGTGCCTCCCGTGGG - Intergenic
1105951172 13:25230592-25230614 TCCTACCACATGCCCCCATCTGG + Intergenic
1106551362 13:30773994-30774016 CCCTACCAATTGTCTCCAGCTGG - Intergenic
1111572336 13:90104627-90104649 CCCAACCTCAGGCTTCCAGGAGG + Intergenic
1112381800 13:98897910-98897932 CCCAACCACATGCCTCCAGCTGG - Intronic
1113297487 13:108975714-108975736 CCCAACCACCTGCCTCAAAAAGG - Intronic
1113458259 13:110464238-110464260 TCCGACCACCTGCCCCCAGCTGG - Intronic
1116996932 14:51334345-51334367 CCCACCCACAGGCCTCCACTTGG - Intergenic
1117247083 14:53897130-53897152 CCCCACCACAACCCACCAGCTGG - Intergenic
1117744931 14:58860172-58860194 CCCAACCTCAGGCCCCCAGGAGG + Intergenic
1121118400 14:91359584-91359606 CCCAACGCCATGCCTCTGGCTGG + Intronic
1122313386 14:100811480-100811502 CCCCACCATTGGCCTCCAGCAGG - Intergenic
1122575290 14:102738097-102738119 CCTGACCACCTGTCTCCAGCAGG - Intergenic
1123943319 15:25227066-25227088 CCCCAGCTCATGCATCCAGCAGG - Intergenic
1125956216 15:43792733-43792755 CCCCAAAACACGCCTCCAGCTGG + Intronic
1127813416 15:62584523-62584545 CCCAACCCCCAGCCTCTAGCTGG + Intronic
1128937764 15:71762595-71762617 CCCATCCTCATTCCTCCTGCAGG + Intronic
1129184315 15:73896670-73896692 CCCAACCACAGGCCTAAAGAAGG + Intergenic
1130333966 15:82943036-82943058 CCCAACCACCTAACTCCAGACGG + Intronic
1132013908 15:98299684-98299706 CCCACCCAGAGGGCTCCAGCCGG + Intergenic
1132043819 15:98547874-98547896 ACCAGCCCCATGCCCCCAGCGGG - Intergenic
1132513362 16:354557-354579 CCCAACCAGATGCCCACAGGTGG + Intergenic
1134022962 16:10934116-10934138 GTCTACCACGTGCCTCCAGCTGG + Intronic
1134717600 16:16364650-16364672 GCCAGGCACATGCCACCAGCCGG - Intergenic
1134957152 16:18387509-18387531 GCCAGGCACATGCCACCAGCCGG + Intergenic
1135298286 16:21301782-21301804 CCCAACCACCAGCCGCCCGCGGG - Intronic
1135851476 16:25967817-25967839 CCCACCCACAAGCCCACAGCTGG - Intronic
1137572884 16:49578296-49578318 CCCAGCCCCCTGGCTCCAGCGGG + Intronic
1137671563 16:50282350-50282372 CCCAGCCTCTTGCTTCCAGCAGG + Intronic
1139375861 16:66495807-66495829 CCCAGCCACAAGCCTCCATCAGG + Intronic
1140794582 16:78425150-78425172 TCCACCCACATGTCTCAAGCAGG - Intronic
1141634968 16:85309779-85309801 CCCAACCCCAGGCCGCCAGCCGG - Intergenic
1141790342 16:86230140-86230162 CTCAGCCACATGTCTCCTGCTGG + Intergenic
1143165761 17:4896608-4896630 CCCAGCCACATGCCCCGAGGTGG + Intronic
1145824798 17:27868749-27868771 CCAAACTCCATGCCTCCATCTGG + Intronic
1145975392 17:28981231-28981253 CCAATCTACATGCCTCCTGCAGG + Intronic
1146930750 17:36776188-36776210 CCCAACCTCCACCCTCCAGCAGG - Intergenic
1148749368 17:49935702-49935724 CCCCACCCCACGCCTCCACCCGG - Intergenic
1149368513 17:55969348-55969370 CCCAGCCTCATGCCCTCAGCAGG - Intergenic
1150318208 17:64187705-64187727 TCCAAGCACATGCCTACAGCGGG + Intronic
1151479177 17:74360320-74360342 CCCATGCATATGTCTCCAGCTGG - Intronic
1152105962 17:78329381-78329403 CCCATCCACCTACCGCCAGCAGG - Intergenic
1152235046 17:79134294-79134316 TCCAACCACATTCCACCAGGTGG - Intronic
1152324331 17:79626838-79626860 CTCAGCCACCTGCCTCCAGATGG + Intergenic
1152793806 17:82296881-82296903 CCCAACCACCTGCCAGCTGCTGG + Intergenic
1152875583 17:82784829-82784851 CCACACCCCATGCCACCAGCCGG - Intronic
1154032362 18:10765125-10765147 CCCTCCCACATGCCTCCTGCGGG - Intronic
1156297109 18:35802737-35802759 CTGAGCCACATGTCTCCAGCAGG - Intergenic
1157421555 18:47551549-47551571 GCTAGCCACATCCCTCCAGCAGG - Intergenic
1157802066 18:50628728-50628750 CCCACCCACATTCCTCCTGTGGG + Intronic
1159781796 18:72668301-72668323 CCCAACAACATGTGTCCAGGAGG + Intergenic
1161899843 19:7110211-7110233 CCAGACCACCTACCTCCAGCTGG - Intergenic
1161946870 19:7442836-7442858 CACAGCCAGATGCCACCAGCAGG - Intronic
1162106616 19:8373698-8373720 CCAAACCACCAGCCTCCTGCCGG - Exonic
1162323694 19:9986032-9986054 CCCAAGGACATGCCCCTAGCAGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163659628 19:18568879-18568901 CCCAGCCCCACGACTCCAGCTGG - Exonic
1164715516 19:30387849-30387871 CCCAACCCCATCCCTCAAGCAGG - Intronic
1164872834 19:31660620-31660642 GCCAACTAAATACCTCCAGCTGG - Intergenic
1164896014 19:31878414-31878436 CCCAAACAGTTGCCTCCAGAAGG + Intergenic
1165284838 19:34832969-34832991 CCCAACCGCCTGCCCCCAACCGG - Intergenic
1165321618 19:35088894-35088916 CCAATCCACATGCGTCCAGCTGG - Intergenic
926223985 2:10954627-10954649 CCCACCCACATGTCTCCTGCAGG + Intergenic
926796570 2:16624465-16624487 CCCAACCACATGCCTGAGGTGGG - Intronic
927521920 2:23704060-23704082 CCCAACCCCGGGGCTCCAGCTGG + Intronic
928332524 2:30368585-30368607 CACAAGCCCAGGCCTCCAGCAGG - Intergenic
928471659 2:31581519-31581541 CCCCACCACACGCCCCCGGCAGG + Intergenic
930442047 2:51421039-51421061 CACAGGCACATGCCACCAGCAGG - Intergenic
934015140 2:87872674-87872696 CCCAACACCAAGCCTCCAACAGG + Intergenic
934213495 2:90006834-90006856 CCCAACCACATGGCATCTGCTGG - Intergenic
936556972 2:113504126-113504148 CCCAAGCAGATGCCTCTGGCGGG + Intergenic
937092599 2:119216421-119216443 CCCAACCAGAGGCCTGCTGCAGG + Intergenic
937991724 2:127666071-127666093 CCCAATCCCATCCCTGCAGCAGG - Intronic
939022079 2:136969945-136969967 CCCAACCACATGCCTACAAAAGG + Intronic
939779213 2:146423774-146423796 CCCACCCACAGCCCTCCAACAGG - Intergenic
940645090 2:156383217-156383239 TCCAACCCATTGCCTCCAGCTGG - Intergenic
941784995 2:169488548-169488570 CCCAACCACTCACCTCCTGCTGG + Intronic
942213377 2:173693886-173693908 CCCAACCCCATCCCCCCAACAGG + Intergenic
944669109 2:201980692-201980714 CACAACCACGTGTCTCCTGCTGG - Intergenic
944968814 2:204967802-204967824 GCCAACCACATCTCTCCATCTGG - Intronic
946399489 2:219461014-219461036 CCCCACCCCAAGCCCCCAGCAGG - Intronic
947523895 2:230866910-230866932 CCCAAACCCATGCCATCAGCAGG - Intronic
948625235 2:239264519-239264541 GCCAACCACATGCGACCAGAGGG + Intronic
948818933 2:240528680-240528702 CCCAGCCACATCCCCCCACCAGG + Intronic
1172654171 20:36526725-36526747 CCCCACCATATGCCGGCAGCTGG - Intronic
1172971227 20:38874303-38874325 CCCCACCTCCTGGCTCCAGCAGG - Intronic
1172980543 20:38938260-38938282 CCCATGCCCCTGCCTCCAGCAGG + Intronic
1174035838 20:47667802-47667824 CGCCACCACCTGCCTCCAGCTGG - Intronic
1174259885 20:49286234-49286256 CCAAACCCCATGCATCAAGCCGG - Intergenic
1175524840 20:59626533-59626555 CCCAAGCACATGCCTGCTGCAGG - Intronic
1175905277 20:62376551-62376573 CCCTGCCACATTCCTCCACCTGG - Intergenic
1176515191 21:7778509-7778531 CCCCGCCACATGCGTGCAGCAGG - Intergenic
1178437944 21:32575910-32575932 CCCAGCCACACGCCTTCTGCTGG + Intergenic
1178649219 21:34408521-34408543 CCCCGCCACATGCGTGCAGCAGG - Intergenic
1179346834 21:40566155-40566177 CCAAAGCACATGCTTACAGCAGG - Intronic
1179920741 21:44505934-44505956 ACCAAGCTCCTGCCTCCAGCAGG - Intronic
1181022704 22:20112085-20112107 CTCCACCCCATGCCCCCAGCTGG + Exonic
1182021726 22:27087070-27087092 CCCCACCCCCTGCCCCCAGCTGG - Intergenic
1182461945 22:30489613-30489635 CTCACCCAGCTGCCTCCAGCTGG + Exonic
1183193070 22:36334297-36334319 CCCAACACCATGGCTGCAGCCGG - Intronic
1183433055 22:37777413-37777435 CCCTACCTGCTGCCTCCAGCTGG + Intergenic
1184403455 22:44286895-44286917 CCCAAACACATGCCTGCAGCAGG - Intronic
1185171183 22:49295544-49295566 CCCCTCCCCATGTCTCCAGCTGG + Intergenic
950136221 3:10582842-10582864 CCACACCACATGGCTCCAGCTGG + Intronic
950453595 3:13079430-13079452 CCCAGCCACTTGCCTCCTTCTGG + Intergenic
951522103 3:23619979-23620001 CCCAACCACAAGGCCCCTGCTGG + Intergenic
953747043 3:45583138-45583160 GCTAGGCACATGCCTCCAGCTGG + Intronic
955518843 3:59754859-59754881 CAGAACCACATGCTTCCATCTGG - Intronic
956490553 3:69767147-69767169 CCAAAGCACATGTCTCCATCTGG + Intronic
959562562 3:107799241-107799263 CCCAGCCACATGCAGCCTGCAGG + Intronic
961101362 3:124201951-124201973 CCCCATCACAGGGCTCCAGCTGG - Intronic
961158783 3:124704288-124704310 AGCAAACACATGCCTCCAGGAGG - Intronic
961321886 3:126082586-126082608 CCCAACCCCATGCTGGCAGCTGG - Intronic
961329181 3:126128838-126128860 CCCAACCCCATGCTGGCAGCTGG + Intronic
961377199 3:126475214-126475236 CCCAACCACAGCCCTCCAGTGGG + Exonic
962527219 3:136247645-136247667 CCCACCCACCTGCCCCAAGCTGG + Intergenic
964668562 3:159200569-159200591 CCCAACCACCATCCTCCAGCAGG + Intronic
965859064 3:173125146-173125168 GCCAACCACATCCCCCCAGTTGG + Intronic
965999644 3:174932119-174932141 CCGCACCACATGCCTCCATCAGG - Intronic
966321398 3:178705108-178705130 CCCAACCCCAATCCTCAAGCTGG + Intronic
968683417 4:1938123-1938145 CTTAACCACATGACTGCAGCGGG + Intronic
968877468 4:3280575-3280597 CCCAGCCACAAGCCTCCTCCAGG - Intergenic
969531365 4:7732899-7732921 CCCAGCCCCATGGCTCCAGAGGG + Intronic
971894822 4:32579088-32579110 CCCAACCTCTTGCCTCAATCTGG - Intergenic
975362433 4:73486623-73486645 TCCATCCACATGCTACCAGCTGG - Intronic
978236289 4:106465024-106465046 AGCAACCACTTGGCTCCAGCAGG + Intergenic
981047819 4:140281630-140281652 CCCCAGCACCTGCTTCCAGCTGG - Intronic
981949042 4:150383867-150383889 CCCATCCATCTGCCTCCAGGTGG + Intronic
985851114 5:2389655-2389677 CCCAGGCACATGCCCACAGCAGG + Intergenic
986203369 5:5599809-5599831 CCCTACCACATACCACCACCAGG - Intergenic
986285576 5:6356021-6356043 GCCAACCCCTTGCCTCCAGGAGG - Intergenic
990990850 5:61682458-61682480 ACCAAACACATGTTTCCAGCTGG + Intronic
992027064 5:72681159-72681181 CCCAACCTCAGGCCCCCAGGAGG + Intergenic
995362105 5:111309228-111309250 CCAAACCAAATGCCTCCTGAAGG + Intronic
997998248 5:138603727-138603749 CCCAACCACATGACAGCTGCTGG + Intergenic
999269883 5:150290594-150290616 CCCAACCCCATGCCCCCAACGGG + Intergenic
1000977231 5:167778502-167778524 CACAACCATATGACTCTAGCAGG - Intronic
1001871429 5:175159563-175159585 CCCAACCCCCTGCCACCATCTGG - Intergenic
1002193723 5:177491561-177491583 CCCAACCCCCAGCCGCCAGCAGG + Intronic
1004551434 6:16651709-16651731 TCCTCCCACATGACTCCAGCTGG - Intronic
1005490005 6:26339055-26339077 CCCAAGCACAGAGCTCCAGCTGG - Intergenic
1005911380 6:30312872-30312894 CCCAACTGCATGCCTGCATCAGG + Intergenic
1006523771 6:34587384-34587406 CCCCACCACAAACATCCAGCTGG + Exonic
1006795212 6:36727813-36727835 TCCAACCACATGCCCTCAGTGGG - Intronic
1006806491 6:36792727-36792749 CCCCAGCACATCCCTCCAGGAGG + Intronic
1011311865 6:85988467-85988489 ACCAAACACATGCCTGCAGCTGG - Intergenic
1017967942 6:159282727-159282749 CACAACCAAATGGCTCAAGCCGG + Intergenic
1018795069 6:167179400-167179422 CCCAGCCAGACGCCTTCAGCTGG - Intronic
1018821249 6:167375662-167375684 CCCAGCCAGACGCCTTCAGCTGG + Intronic
1019647677 7:2139717-2139739 CCCGTCCAGATGGCTCCAGCAGG + Intronic
1020117254 7:5482648-5482670 ACCAACCACAGTCCCCCAGCGGG + Intronic
1020130289 7:5555538-5555560 CCCAACCCCGTGGCCCCAGCCGG - Intronic
1020706412 7:11549762-11549784 CCCAACCACACTCCCCCAACAGG - Intronic
1021994601 7:26167392-26167414 CCCTACCACATCCCTCTGGCTGG - Intronic
1022298834 7:29083429-29083451 TCCAACCACCTGGGTCCAGCTGG + Intronic
1023659004 7:42454377-42454399 CCCAGCCCCAGGCCTCCCGCAGG - Intergenic
1029143067 7:98425278-98425300 GCCACCCACATGCCTCCACTTGG - Intergenic
1029515718 7:101021816-101021838 CCCAGCCCCATGACTTCAGCAGG - Intronic
1033222309 7:139536275-139536297 CACCACCACACGCCTCCTGCTGG + Exonic
1034960463 7:155361396-155361418 TCCATCCACATTCCACCAGCTGG - Intronic
1037488738 8:19376185-19376207 CCCATCCAAATGCCCCCTGCTGG + Intronic
1041015152 8:53585617-53585639 CCCAACCTCATACCACCAGTGGG + Intergenic
1041830486 8:62147716-62147738 CCCAATCTCAGGCCTGCAGCTGG + Intergenic
1042941099 8:74108860-74108882 CCAAAACACATGCCATCAGCAGG + Intergenic
1044158111 8:88875931-88875953 CTCAAACACATGCCTCCATCAGG + Intergenic
1048759819 8:137781794-137781816 ACCAGCCACATGCCTCCCGAGGG + Intergenic
1049161989 8:141103631-141103653 CCCACCCACATGCCTCTGCCAGG + Intergenic
1049223595 8:141439149-141439171 TCCAACCACAGGCCTCCACATGG - Intergenic
1049415012 8:142491109-142491131 CCCAGCCCCATGCCCACAGCAGG + Intronic
1049538900 8:143197206-143197228 CACAGCCAAATGCCCCCAGCAGG + Intergenic
1049896029 9:113175-113197 CCCAAGCAGATGCCTCCGGCGGG - Intergenic
1053463350 9:38287707-38287729 CCCCAACACATGCCTGCAGGTGG - Intergenic
1055204891 9:73716862-73716884 CCGAAGCACATTTCTCCAGCTGG + Intergenic
1060268670 9:122126693-122126715 CCGGACCACCTGCCTCCTGCCGG - Intergenic
1061223691 9:129267533-129267555 CCCATCCACTTGCCCCCTGCTGG - Intergenic
1061551386 9:131336794-131336816 CTCAAACACAAGCCTCCTGCTGG - Intergenic
1062117959 9:134819163-134819185 CCCCACCACCAGCCTGCAGCAGG - Intronic
1062183381 9:135203092-135203114 ACCCACCACATGCCTCCCCCAGG + Intergenic
1186456854 X:9716514-9716536 CCAATCCACACGCCTCGAGCTGG - Exonic
1186475548 X:9854457-9854479 CCCATCCAGGTGCCTTCAGCAGG - Intronic
1186909268 X:14144067-14144089 GCCAGCCACATCCCTCCAGAAGG - Intergenic
1188060023 X:25590175-25590197 CCCAACCTCAGGCCTCCAGGAGG + Intergenic
1189921028 X:45903513-45903535 CCCACCCTCCTGTCTCCAGCTGG - Intergenic
1190123917 X:47686742-47686764 CCCAATGCCATGCCCCCAGCAGG - Intergenic
1190283103 X:48944280-48944302 CCCCACCTCTTCCCTCCAGCAGG - Exonic
1192044206 X:67654879-67654901 CCAAACCACATTCCTCCAAGAGG - Intronic
1192177361 X:68894418-68894440 CCCAGCAGCAAGCCTCCAGCTGG - Intergenic
1192260449 X:69503611-69503633 CCCAAGCACATGGTTCCATCCGG + Intergenic
1195536537 X:106014270-106014292 CCCAACCTCAGGCCTCCAGGAGG + Intergenic
1195786343 X:108527786-108527808 CCCAACCTCAGGCCCCCAGGAGG - Intronic
1197433715 X:126399280-126399302 CCCACGCAAATGCCTACAGCTGG + Intergenic
1197711955 X:129678083-129678105 CCCACCCTCATGCCTCCTCCCGG + Intergenic
1197936755 X:131747505-131747527 CTAAACCACCTGCCTCCATCAGG + Intergenic
1199129338 X:144165834-144165856 CCCAACACCAAGCCTCCAACAGG - Intergenic
1200005917 X:153084029-153084051 CCAAACCACACTCCTCCAGAGGG - Intergenic