ID: 1112382195

View in Genome Browser
Species Human (GRCh38)
Location 13:98902360-98902382
Sequence CATCAGCGCCGGGGACGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112382187_1112382195 11 Left 1112382187 13:98902326-98902348 CCTTGAGGACAGATGGGCTCTGC 0: 1
1: 0
2: 1
3: 27
4: 224
Right 1112382195 13:98902360-98902382 CATCAGCGCCGGGGACGTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 141
1112382186_1112382195 12 Left 1112382186 13:98902325-98902347 CCCTTGAGGACAGATGGGCTCTG 0: 1
1: 0
2: 1
3: 24
4: 181
Right 1112382195 13:98902360-98902382 CATCAGCGCCGGGGACGTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112382195 Original CRISPR CATCAGCGCCGGGGACGTGG TGG Exonic
900863845 1:5253244-5253266 CATCAGCTCCAGGGGCGTGCGGG - Intergenic
904511939 1:31018263-31018285 CATCTGAGCCTGGGAGGTGGAGG + Intronic
905741437 1:40374255-40374277 CAGCCGCGCCGGGGTGGTGGGGG + Intronic
912915743 1:113812525-113812547 ACTCAGAGCCGGGGACGCGGCGG - Intergenic
913971621 1:143421698-143421720 CAGCAGAGCTGAGGACGTGGAGG + Intergenic
914065998 1:144247311-144247333 CAGCAGAGCTGAGGACGTGGAGG + Intergenic
914113153 1:144719043-144719065 CAGCAGAGCTGAGGACGTGGAGG - Intergenic
917968117 1:180191293-180191315 CATCAGGGCTAGGGCCGTGGTGG + Intronic
918023611 1:180720107-180720129 GAGCAGGGCCGGGGGCGTGGGGG + Intronic
919763416 1:201112160-201112182 CTTCAGGGCCCGGGCCGTGGGGG - Intronic
921094813 1:211877236-211877258 CTTCAGTGGAGGGGACGTGGTGG + Intergenic
922239969 1:223749041-223749063 CACCAGCGCCGCGGACTCGGAGG + Exonic
1063000024 10:1908512-1908534 CGTCAGCCCCGGGGAGGTTGAGG + Intergenic
1064720666 10:18225721-18225743 CATTAGAGCCCGGGAGGTGGAGG - Intronic
1069068729 10:63973377-63973399 CCTCAGCGCCTGGTACGGGGCGG - Intergenic
1069926756 10:71855853-71855875 CATCAGTCCAGGGGAGGTGGGGG - Intergenic
1070708190 10:78656914-78656936 CATCAGCTCCAGAGACGGGGCGG - Intergenic
1073123611 10:101136336-101136358 CCTCAGGGCCGGGGAGGGGGAGG + Intronic
1073299142 10:102460232-102460254 CATCTGAGCCAGGGAGGTGGAGG + Intergenic
1078136844 11:8658774-8658796 CTTCAGTGCCGGGGGCATGGAGG - Intronic
1079071547 11:17351989-17352011 CAGGAGCGCCGCGCACGTGGAGG - Exonic
1081929434 11:46858540-46858562 CATCAGGGGCTGGGACATGGGGG - Exonic
1083714684 11:64568545-64568567 CAGCAGGGCCGGGGACTTGTAGG + Intronic
1086675422 11:89601134-89601156 CACCAGGGCCGAGGAGGTGGGGG - Intergenic
1086959753 11:92969872-92969894 CACCACCGCCGTGGACGTCGTGG + Exonic
1088013819 11:105035697-105035719 CATCTGAGCCTGGGAAGTGGAGG - Intergenic
1088498852 11:110461410-110461432 CACCAGGGCCTGGGAGGTGGAGG + Intronic
1089400008 11:118158999-118159021 TATCAGTGGTGGGGACGTGGGGG - Intergenic
1090796769 11:130142053-130142075 CATCAGCCACGGGATCGTGGAGG + Exonic
1090837294 11:130462684-130462706 CATCGGCCCAGGGGAAGTGGCGG - Exonic
1091596965 12:1884812-1884834 CATCAGCGACGGCGCCGTGGAGG - Exonic
1102937574 12:116910879-116910901 GGGCAGCGCCGGGGGCGTGGCGG + Intergenic
1104918260 12:132277651-132277673 CAGCAGAGCCGGGGCCGCGGGGG - Intronic
1105578958 13:21675835-21675857 CAGCAGTGCAGAGGACGTGGGGG + Intronic
1106595199 13:31129635-31129657 CATCAGCGCCTGGGGGTTGGAGG + Intergenic
1109789192 13:67225965-67225987 CATCATCGCCGGTGCCATGGTGG - Exonic
1110547930 13:76777286-76777308 CATCATCCCCGGGGACTTAGAGG + Intergenic
1112382195 13:98902360-98902382 CATCAGCGCCGGGGACGTGGTGG + Exonic
1115566650 14:34630233-34630255 GACCAGCGCCGGGGACGGGGCGG - Intergenic
1120941798 14:89956312-89956334 CTTAAGCGCCTGGCACGTGGTGG - Intronic
1121853075 14:97240539-97240561 GATCAGCGATGGGGACCTGGAGG - Intergenic
1122692564 14:103538214-103538236 CAACAGCCCCGGGGCTGTGGGGG - Intergenic
1122695927 14:103552054-103552076 CAACAGCACCGAGGACATGGAGG + Intergenic
1122784559 14:104157805-104157827 CATCAGGGCCGGCCACGGGGGGG - Exonic
1123016114 14:105376532-105376554 CACCAGCCCAGGGGAGGTGGAGG + Intronic
1124962016 15:34405754-34405776 CATCAGAGCCTGGGAGGTTGTGG + Intronic
1124966156 15:34434805-34434827 CGTGAGCACTGGGGACGTGGAGG - Intronic
1124978639 15:34551975-34551997 CATCAGAGCCTGGGAGGTTGTGG + Intronic
1127366296 15:58293796-58293818 CATCTGCACCGTGGACGTGTTGG + Intronic
1133168106 16:3963414-3963436 CATCGGAGCAGGGGACGGGGAGG + Exonic
1133244997 16:4442621-4442643 CAGCAGCTCCGGGGGCGGGGCGG + Intronic
1134536014 16:15027652-15027674 CATCAACCACGGGGACGAGGCGG - Intronic
1135721039 16:24818544-24818566 CACCAGAGCAAGGGACGTGGAGG - Intronic
1138030918 16:53558840-53558862 CTTCAGTCCCGGGGACTTGGCGG + Intergenic
1139424453 16:66870607-66870629 CATCTGAGCCCGGGAGGTGGAGG + Intronic
1139923350 16:70472977-70472999 CATCAGAGCCTGGGACCTGTGGG + Exonic
1140287160 16:73614841-73614863 CATCTGAGCCTGGGAGGTGGAGG - Intergenic
1142961322 17:3554052-3554074 CTTCTTCGCTGGGGACGTGGAGG - Intronic
1142967361 17:3589998-3590020 CATCAGCGCCAGGGACTCGGTGG - Exonic
1148214285 17:45825916-45825938 CTGCAGCGCCTGGGACGAGGTGG + Intronic
1149997253 17:61411757-61411779 CAGCAGCGGCGGGGGAGTGGAGG - Exonic
1150228651 17:63538050-63538072 CATCAGGGCTGGGGGCGGGGCGG - Exonic
1150345308 17:64399974-64399996 CTTCAGTGCCTGGGACATGGTGG - Intronic
1150690985 17:67366636-67366658 AACCAGCGCCGGGGACCTCGAGG - Intergenic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1159961112 18:74556396-74556418 TAACAGCGCCGGGGGCGGGGAGG - Exonic
1160866936 19:1260316-1260338 CATCCGCACCAGGGACGGGGCGG - Intronic
1161490190 19:4557172-4557194 CCGCAGCTCCGTGGACGTGGGGG + Exonic
1163778502 19:19232369-19232391 CAGCAGCGCGGGGCACCTGGCGG + Intronic
1167698447 19:51028397-51028419 CACCCGAGCCGGGGAGGTGGAGG - Intergenic
925889896 2:8425181-8425203 CAACAGCGCAGTGGCCGTGGTGG + Intergenic
927673107 2:25085546-25085568 CACTTGAGCCGGGGACGTGGAGG - Intronic
929601149 2:43205656-43205678 CATCTGAGTCTGGGACGTGGAGG - Intergenic
930096515 2:47570507-47570529 CCTGAGCGCCGGGGAGGAGGCGG - Exonic
930152926 2:48076839-48076861 CCTCAGCGCCAGGGAAATGGTGG + Intergenic
932430792 2:71672606-71672628 AATGAGCGCCTGGGACCTGGGGG + Intronic
932605674 2:73163820-73163842 CAGGAGCGCCGTGGAGGTGGGGG + Intergenic
932766212 2:74472157-74472179 CATCCGGGCCAGGGACGCGGCGG - Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
940036802 2:149320375-149320397 CATCAGCGGCGGTGGCCTGGGGG - Intergenic
946326001 2:218985073-218985095 CATCGCCGCCGGGGACTGGGCGG + Exonic
947876145 2:233469483-233469505 CCTCGGCGGCGGGGATGTGGAGG - Exonic
948699261 2:239750242-239750264 GATGAGCGCAGGGGACGAGGGGG - Intergenic
949001251 2:241615464-241615486 CCTCAGAGCAGGGGATGTGGTGG + Intronic
1170630894 20:18063909-18063931 CACCTGAGCCCGGGACGTGGCGG + Intergenic
1173792115 20:45834368-45834390 CACCAGCGCCGAGGACGACGAGG + Exonic
1175086330 20:56462140-56462162 CATCACCCCCTGGGACTTGGAGG - Intergenic
1176104069 20:63377445-63377467 TCTCAGAGCCGGGGAGGTGGCGG - Intronic
1176168760 20:63687817-63687839 CATCAGCGGGGTGGAAGTGGTGG + Intronic
1179469466 21:41601044-41601066 CATCTGAGCCGGGGAGGTGGAGG + Intergenic
1180919801 22:19515885-19515907 CAACAGGGCCGGGCAGGTGGTGG - Intronic
1181164066 22:20974115-20974137 CATCAGCACTGGGGACCTGGAGG + Exonic
1181536592 22:23549438-23549460 CATCAGCGCTGGGGGTCTGGAGG - Intergenic
1182901737 22:33904134-33904156 TACCAGCTCCGGGGATGTGGTGG + Intronic
1183486165 22:38088809-38088831 CTTCTCCGCTGGGGACGTGGTGG - Exonic
1183911248 22:41080919-41080941 CAGCTGAGCCGGGGACTTGGAGG + Intergenic
1184101366 22:42343384-42343406 CATCCGCGTCTGGCACGTGGGGG - Intronic
950101093 3:10357476-10357498 CATCAGGGCCAGGAACTTGGAGG + Intronic
950345525 3:12288468-12288490 CACCTCCGCCGGGGACGCGGAGG - Intronic
966432450 3:179846485-179846507 CATCACAGCTGGGGAGGTGGTGG - Intronic
968161734 3:196432358-196432380 CTTCAGCGCCGAGGACGCCGCGG + Exonic
969704888 4:8786251-8786273 CATCAGCCCCAGGGATGTGAGGG - Intergenic
972537384 4:40010904-40010926 CATCTGAGCCTGGGAGGTGGAGG - Intergenic
985532784 5:443588-443610 CACCAGCGCCTGGGGCGTGGGGG - Intronic
985641114 5:1063852-1063874 CATCAGCGCCGAGGTGGAGGTGG - Exonic
986322394 5:6643386-6643408 CATCAGAGCCTGGGAGGTGGAGG - Intronic
988549456 5:32186792-32186814 CATCAGAGCCCAGGAGGTGGAGG + Intergenic
988587665 5:32522106-32522128 CATCTGAGCCTGGGAGGTGGAGG - Intergenic
989229752 5:39073668-39073690 CTTCTGCTCCGGGGACGGGGAGG + Intronic
992631896 5:78689853-78689875 CATCTGAGCCTGGGAGGTGGAGG + Intronic
992715324 5:79505173-79505195 CATCTGAGCCTGGGACATGGAGG + Intronic
996948196 5:129094805-129094827 CAGCGGCGCCGGGGGCGCGGGGG + Exonic
1002419495 5:179138230-179138252 CATCAGTGCTGGGGAGGAGGTGG - Intronic
1002601771 5:180357643-180357665 CCTCAGCCCCGGGGTGGTGGTGG - Intergenic
1002957116 6:1877095-1877117 CATCACCGGGTGGGACGTGGTGG - Intronic
1004458884 6:15817239-15817261 CATCAGCTCCTGGGGCCTGGAGG + Intergenic
1005289327 6:24363415-24363437 CATCAGAGCCTGGGAAGTTGAGG + Intergenic
1007251626 6:40499248-40499270 CATCAGGGCTGGGGAGATGGGGG - Intronic
1007398853 6:41592253-41592275 CACCAGCGCCCAGGACTTGGTGG + Intronic
1008013291 6:46491091-46491113 CAGCAGCCCCGGGGTCGTGCCGG - Intronic
1016260120 6:142159278-142159300 CATCTGCGCCCAGGAAGTGGAGG + Intronic
1019213631 6:170425346-170425368 CATGAGAGCCGGGGTCATGGGGG + Intergenic
1019475845 7:1243922-1243944 GAACAGAGCCGGAGACGTGGGGG - Intergenic
1019783660 7:2959583-2959605 CCTCAGCCCCGGGGAGGTGGTGG + Intronic
1021114229 7:16730440-16730462 CATCTGAGCCCGGGAGGTGGAGG + Intergenic
1022378878 7:29841327-29841349 CATCAGCGACGGAGATGAGGAGG - Intronic
1024227018 7:47333202-47333224 CATCAGTGCTGGGTTCGTGGAGG - Intronic
1025285964 7:57661099-57661121 CATCTGAGCCCGGGAGGTGGAGG - Intergenic
1026852883 7:73735861-73735883 CATCAGGGCCTGGGAGGTGTGGG + Intergenic
1029485383 7:100836785-100836807 CATCTGCCCCTGGGACCTGGGGG + Intronic
1029688413 7:102164626-102164648 CATCAGCGTGGGACACGTGGTGG + Intronic
1031313737 7:120231512-120231534 CATCTGAGCCTGGGAGGTGGAGG + Intergenic
1034463263 7:151210272-151210294 CAGCAGCCCGGGGGCCGTGGGGG - Intronic
1040566368 8:48571310-48571332 CATGAGCACCGGGCACCTGGGGG + Intergenic
1041260260 8:56015519-56015541 CATCTGAGCCCGGGAGGTGGAGG - Intergenic
1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG + Intronic
1044988542 8:97775781-97775803 CTGCAGCGGCGGGGACGGGGAGG - Exonic
1049176567 8:141196430-141196452 CATCAGTGATGGGGACTTGGGGG - Intergenic
1049223821 8:141440279-141440301 CCTCAGGGCTGGGGTCGTGGAGG + Intergenic
1056801713 9:89696761-89696783 CATCAGCACCCAGGAAGTGGAGG - Intergenic
1058865336 9:109156763-109156785 CACCTGAGCCGGGGAGGTGGAGG - Intronic
1059916319 9:119105740-119105762 CATCTGAGCCTGGGAAGTGGAGG + Intergenic
1060523917 9:124309907-124309929 CCTCAGTGCAGAGGACGTGGAGG + Intronic
1061784487 9:133018352-133018374 CACCAGAGCCCGGGAGGTGGAGG + Intergenic
1062044551 9:134418993-134419015 GAGCAGAGCCGGGGACGTGGGGG - Intronic
1185712766 X:2317333-2317355 CATCTGAGCCCGGGAGGTGGAGG - Intronic
1185734989 X:2489591-2489613 CGTCATCGCCGGGGTCTTGGTGG - Exonic
1186395775 X:9207375-9207397 CAACATCCCCGGGGAAGTGGCGG - Intergenic
1188946929 X:36316867-36316889 CATCTGAGCCCGGGAGGTGGAGG - Intronic
1190093795 X:47462839-47462861 CATCTGAGCCTGGGAGGTGGAGG - Intronic
1200120035 X:153785877-153785899 CATCAACGGCCGGGCCGTGGAGG - Exonic