ID: 1112383656

View in Genome Browser
Species Human (GRCh38)
Location 13:98917893-98917915
Sequence GGAGATGCCCCCTTTAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112383646_1112383656 16 Left 1112383646 13:98917854-98917876 CCGGGGGTTCCACCTGGCGGCAC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1112383647_1112383656 7 Left 1112383647 13:98917863-98917885 CCACCTGGCGGCACCAGCTGCAG 0: 1
1: 0
2: 5
3: 51
4: 279
Right 1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1112383653_1112383656 -6 Left 1112383653 13:98917876-98917898 CCAGCTGCAGGTGGGCAGGAGAT 0: 1
1: 0
2: 1
3: 40
4: 290
Right 1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1112383643_1112383656 24 Left 1112383643 13:98917846-98917868 CCTTTGAGCCGGGGGTTCCACCT 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG 0: 1
1: 0
2: 1
3: 9
4: 107
1112383649_1112383656 4 Left 1112383649 13:98917866-98917888 CCTGGCGGCACCAGCTGCAGGTG 0: 1
1: 0
2: 0
3: 20
4: 276
Right 1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112383656 Original CRISPR GGAGATGCCCCCTTTAAATG GGG Intronic
905096009 1:35471498-35471520 GGAGATGGCCCATTTAAAACAGG + Intronic
905390381 1:37632570-37632592 GCATATGCTCCCTTTAGATGGGG - Intronic
906267152 1:44441129-44441151 GGATTTCCCCCCTTTAACTGGGG - Intronic
907928979 1:58981517-58981539 AGAACTGTCCCCTTTAAATGGGG - Intergenic
911681698 1:100723954-100723976 GGCAATACTCCCTTTAAATGTGG - Intronic
911788839 1:101985111-101985133 GGAGATGCACTTTTAAAATGGGG - Intronic
912770425 1:112458952-112458974 ACAGATGCCCTTTTTAAATGCGG - Exonic
913461013 1:119085936-119085958 GGAGATGAACCCTTTAACTAAGG - Intronic
916296240 1:163223327-163223349 GGAGATGCCACCATTAAGAGGGG - Intronic
916366820 1:164038300-164038322 GGATAGGCAGCCTTTAAATGAGG - Intergenic
917307214 1:173638906-173638928 GGAGAGGCCCCTTTTAAAACAGG + Intronic
917810202 1:178651105-178651127 GGCAGTGACCCCTTTAAATGTGG + Intergenic
919067199 1:192707592-192707614 GCAGATGCCCTCCTTCAATGTGG + Intergenic
919705947 1:200676012-200676034 GGAGATGCCGAATTAAAATGAGG + Intergenic
920335912 1:205245057-205245079 GGAGATGCCCCCTTGGACAGTGG + Intronic
920764990 1:208823747-208823769 GGAGATGACCCCTGCAAGTGAGG + Intergenic
923337368 1:232982102-232982124 AGGGATGCCTCCTCTAAATGGGG + Exonic
1068712054 10:60146284-60146306 GGAGATGCACGCTATTAATGTGG + Intronic
1069599505 10:69694253-69694275 TGAGGTGACCCCTTTAAATTGGG - Intergenic
1070643725 10:78187000-78187022 GGAGAGGCTCCCTTCAAAGGGGG - Intergenic
1074002518 10:109387283-109387305 AGAGAAGCTGCCTTTAAATGTGG - Intergenic
1078346835 11:10557246-10557268 GCAGCTGTCCCCTTTCAATGGGG - Exonic
1079077840 11:17394882-17394904 GAAGATGCCCCCTTGGCATGGGG + Intronic
1079266150 11:18934889-18934911 TGATCTGCCCTCTTTAAATGAGG - Exonic
1080908062 11:36566690-36566712 GGAGATGCAGCCTTTACCTGAGG - Intronic
1090793474 11:130112992-130113014 GGAAAGGCTCCCTTTAAAGGAGG - Intronic
1091806959 12:3363794-3363816 GGAGGTGGCCACTTTAGATGGGG + Intergenic
1094266904 12:28569771-28569793 GGAAATGCTCCCTTGGAATGGGG - Intronic
1096771266 12:53937476-53937498 GGAGATGCTCCCTTAGAAAGGGG + Intergenic
1098245863 12:68517140-68517162 GGAGATGCACCCATTAAAAAAGG + Intergenic
1105341877 13:19534434-19534456 GAAGATGCTCCTTTTGAATGTGG - Intronic
1108620134 13:52174110-52174132 GAAGATGCTCCTTTTGAATGTGG - Intergenic
1108666612 13:52638981-52639003 GAAGATGCTCCTTTTGAATGTGG + Intergenic
1109224712 13:59679141-59679163 GAAGCTGCTCCCTTTTAATGAGG + Intronic
1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG + Intronic
1118913174 14:70078906-70078928 GGTGATGCCCACTTTCAAGGTGG - Intronic
1120345261 14:83280798-83280820 GAAGATGCTCCATTTAAAAGAGG + Intergenic
1120733934 14:88032751-88032773 GGAGATGCTGCCATTAAATTGGG - Intergenic
1122509309 14:102253490-102253512 GGAGATGTCCACTTTAAAGGGGG + Intronic
1123627858 15:22239760-22239782 TGAGATGCCAGCTTTAGATGGGG - Intergenic
1131504185 15:93001263-93001285 GCAGCTGCCCCCTTTACATTAGG - Intronic
1131859753 15:96639991-96640013 GGAAATGCCTCCTACAAATGTGG + Intergenic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1140299464 16:73742037-73742059 TGATATGCACCCTTGAAATGTGG - Intergenic
1140389041 16:74569100-74569122 TGAGATGCCAGCTTTAAGTGAGG - Intronic
1141976100 16:87517592-87517614 TGAGATGCCGGCTTTAGATGGGG + Intergenic
1142864272 17:2780813-2780835 TGAGATGCCCGCTTTAAAAGGGG - Intronic
1143377074 17:6473127-6473149 GGAGTTGCCCCGTGGAAATGGGG - Intronic
1145033173 17:19520701-19520723 GGGCAGGCCCCCTTAAAATGTGG + Intronic
1145978372 17:28997258-28997280 GGAGATGCCCCCTTTGCCAGGGG + Intronic
1146606001 17:34258234-34258256 GAAGCTGCCCCCTTAAAATGTGG - Intergenic
1150811088 17:68357754-68357776 GTAGCTGCCCCCTTCAGATGGGG - Intronic
1153025215 18:666518-666540 GCAGATGCCACCTTGGAATGTGG + Intronic
1156918516 18:42489915-42489937 TGAAATGCTCCCTTCAAATGTGG + Intergenic
1158757520 18:60344567-60344589 GGAGATTTCCATTTTAAATGTGG + Intergenic
1160181257 18:76638582-76638604 GAAGATGCCCCCAATAACTGGGG - Intergenic
1165393637 19:35551996-35552018 GCAGATGCCCCATTTAAAGGGGG + Intronic
1165393638 19:35552003-35552025 GTGGCTGCCCCCTTTAAATGGGG - Intronic
1165963989 19:39559175-39559197 GTGGGTGCACCCTTTAAATGAGG - Intergenic
932117899 2:69069798-69069820 GGAGATGCTCTATTTAAATTGGG - Intronic
933657276 2:84899360-84899382 ACAGCTGCCCCCTTGAAATGAGG - Intronic
935196099 2:100817870-100817892 GTAGATGCCCCTACTAAATGTGG - Intergenic
935581155 2:104756859-104756881 GGTGATTCCACCCTTAAATGTGG - Intergenic
936820183 2:116510769-116510791 GAAGAGGGCCCCATTAAATGAGG + Intergenic
937713464 2:125005164-125005186 GGAGTTTCCCCCTTTATATAAGG + Intergenic
939700476 2:145385338-145385360 GGAGATGCTGACTTTTAATGTGG + Intergenic
939799327 2:146688784-146688806 GGAAATTGCCACTTTAAATGGGG - Intergenic
1168895436 20:1320473-1320495 GCTGATGCCCCCTTGAAAGGAGG + Intronic
1170291842 20:14778867-14778889 GGAGCTTCCCTCATTAAATGAGG - Intronic
1170386591 20:15825168-15825190 AGAGATGCCACCTTTCAGTGGGG - Intronic
1172332414 20:34084509-34084531 AGAGATGCCACCTTTACTTGGGG - Intronic
1173162064 20:40660362-40660384 GCAGATTCCAGCTTTAAATGTGG - Intergenic
1173297984 20:41776339-41776361 GGAGTTGCTACCTGTAAATGTGG + Intergenic
1178141900 21:29693796-29693818 AAAGATGCCCGCTTTAAAAGAGG + Intronic
1183207029 22:36426596-36426618 GGAGGTGCCCCGTGAAAATGGGG - Intergenic
953223995 3:40999628-40999650 GGTGTTGCCACCTTTTAATGTGG - Intergenic
954743624 3:52774273-52774295 GGAGATGAGCCGTCTAAATGAGG + Intergenic
956059666 3:65336673-65336695 AGAGATGCATACTTTAAATGAGG - Intergenic
957856722 3:85888835-85888857 GTGGATTACCCCTTTAAATGAGG - Intronic
959840424 3:110968597-110968619 GGAGAGGCCCCTTTTAAAACAGG - Intergenic
960239262 3:115321225-115321247 GTAGATGCCCCATTTATACGGGG + Intergenic
961871107 3:129988760-129988782 TCAGATGCCCCCTTTCAGTGGGG + Intergenic
963290447 3:143481773-143481795 GGAAGTGTCCCCTTTACATGGGG + Intronic
964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG + Intronic
969665154 4:8553186-8553208 GCACATGCCCCTTTTACATGTGG - Intergenic
971776629 4:30974759-30974781 GGAGTTTCACCCTTTCAATGAGG + Intronic
972067432 4:34967343-34967365 GGACATGGCCACTTTAAATACGG - Intergenic
972720692 4:41694300-41694322 GGAGATCTGCCCTTTTAATGTGG - Intronic
977994319 4:103484082-103484104 GAAGATGCCCCCTTCATGTGAGG + Intergenic
992219785 5:74560404-74560426 GGGGATGCCACATTTAGATGTGG - Intergenic
993387494 5:87277364-87277386 GGAGATACAGCCTTTAAAAGAGG + Intronic
998468775 5:142366942-142366964 GCAGCTGCCCCCTTTAGATGTGG + Intergenic
998761050 5:145432914-145432936 GAAGATGCCCTGTTTAGATGGGG - Intergenic
1004631730 6:17427668-17427690 GGAGATGCTGCTTTTAAATTTGG - Intronic
1005579905 6:27223884-27223906 GGAGATGGGGCCTTTGAATGAGG - Intergenic
1015446647 6:133313204-133313226 GGAGATGCTCCCTTTTATTTTGG + Intronic
1017040402 6:150303872-150303894 GGAGATGTCCCCTCTAAAGAAGG - Intergenic
1022050054 7:26658106-26658128 GGATATGTCCCCTTTTCATGCGG - Intergenic
1032982965 7:137306182-137306204 CCAGTTGCCCTCTTTAAATGGGG + Intronic
1033142703 7:138841653-138841675 GGAGGTGCCTCCTTTAGATATGG - Intronic
1033959551 7:146897079-146897101 AGAGATGCCCTCATAAAATGAGG - Intronic
1033973155 7:147068137-147068159 GCAGATGACCCCTTTAAAAGAGG - Intronic
1036278137 8:7374565-7374587 GGAGATGCCACCTTTCATTAGGG - Intronic
1036343385 8:7937326-7937348 GGAGATGCCACCTTTCATTAGGG + Intronic
1037128557 8:15380515-15380537 GGAGATAGGGCCTTTAAATGCGG + Intergenic
1039175527 8:34799804-34799826 GGAGGTGTCCTCTTTAGATGAGG - Intergenic
1047992410 8:130299502-130299524 GGAGATGCATCCTTTAAAAAGGG - Intronic
1050206095 9:3197834-3197856 GGAGATGCCTCCTTCAAATGTGG - Intergenic
1051172078 9:14329015-14329037 GCAACTGCCCCCTTTAGATGGGG + Intronic
1055265213 9:74487359-74487381 GAAGATGAGCCCTTTAAATCAGG - Intergenic
1057409843 9:94808397-94808419 GGGGATGCCCCCTTCAAAAATGG + Intronic
1058067827 9:100568438-100568460 GAAGGTGCCCTCTTTAAATGAGG + Intronic
1058568814 9:106318071-106318093 GGCAATGCCCCGTTTAATTGGGG + Intergenic
1062011571 9:134269842-134269864 GGAGATGAGCCCTTTAAATCTGG - Intergenic
1187190765 X:17032705-17032727 GGACATGCCCCCTTGTAATCAGG - Intronic
1193274515 X:79570295-79570317 GGAGGTGCCCCCTAGATATGAGG + Intergenic
1193634309 X:83929375-83929397 GGAGAAGCCACTTTTTAATGTGG - Intergenic
1202011532 Y:20345676-20345698 GGACATAACACCTTTAAATGCGG - Intergenic