ID: 1112383761

View in Genome Browser
Species Human (GRCh38)
Location 13:98918793-98918815
Sequence AAGTAGAACAAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1619
Summary {0: 1, 1: 1, 2: 10, 3: 157, 4: 1450}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112383756_1112383761 -9 Left 1112383756 13:98918779-98918801 CCCCCAAAACAAGAAAGTAGAAC 0: 1
1: 0
2: 2
3: 33
4: 508
Right 1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG 0: 1
1: 1
2: 10
3: 157
4: 1450
1112383757_1112383761 -10 Left 1112383757 13:98918780-98918802 CCCCAAAACAAGAAAGTAGAACA 0: 1
1: 0
2: 2
3: 45
4: 676
Right 1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG 0: 1
1: 1
2: 10
3: 157
4: 1450
1112383755_1112383761 17 Left 1112383755 13:98918753-98918775 CCTCAGAAAGCTGCAGAAGATGT 0: 1
1: 0
2: 2
3: 36
4: 358
Right 1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG 0: 1
1: 1
2: 10
3: 157
4: 1450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112383761 Original CRISPR AAGTAGAACAAGAAAGAGGA AGG Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901552987 1:10009871-10009893 AAGAAGAAAAAGAAAAAGAAAGG - Intronic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902075653 1:13782779-13782801 AGTGAGAACAAGAGAGAGGACGG + Exonic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
903491845 1:23735003-23735025 GAGTGGAATAAGAAAGGGGAAGG - Intergenic
903660648 1:24975435-24975457 GAGTAAACCAAGAAAGAGAAAGG - Intergenic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904112821 1:28139985-28140007 AAAAAAAAAAAGAAAGAGGAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904969346 1:34406759-34406781 AAGCAGAACAATAAACAGGAAGG - Intergenic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905362018 1:37427330-37427352 AAAAAAAAAAAGAAAGAGGAGGG + Intergenic
905751483 1:40468406-40468428 AAGAAGAAAAAGAAACTGGATGG + Intergenic
905765095 1:40593856-40593878 GAGAAGAAAAAGAAAGAAGAGGG - Intergenic
905885949 1:41492046-41492068 AAGTAGGAATGGAAAGAGGATGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906516722 1:46443360-46443382 AAGAAGAAAAAGAAGAAGGAGGG - Intergenic
906553378 1:46686215-46686237 AGGAAGAACAAAAAAGGGGAAGG + Intronic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907537844 1:55181280-55181302 AAATAAAACAAAAAACAGGAAGG + Intronic
908136825 1:61141691-61141713 AAGTAGATCAGGAAATAGAAGGG - Intronic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908716669 1:67078071-67078093 AAGTTGAACAGTAAAGAAGAAGG + Intergenic
908739908 1:67316842-67316864 AAGAAGGACATAAAAGAGGAGGG - Intronic
908821443 1:68091394-68091416 AAGAAGAAAAAGAAAAAGCAGGG - Intergenic
908962931 1:69723478-69723500 AAGGAAAACAAGAAAGAAGTCGG - Intronic
908970470 1:69822578-69822600 AAGTGGGGCAAGAAAGAGGTAGG + Intronic
909155695 1:72072895-72072917 AAGTAGTACAAGACACAAGATGG - Intronic
909171512 1:72301888-72301910 AAGAAGAAAAAGAAAAAGGTGGG + Intergenic
909195112 1:72610424-72610446 AAGAAGAAGAAGAAAGAGATAGG - Intergenic
909253645 1:73390471-73390493 AAGTAGGACGAGGAGGAGGAAGG - Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
909779053 1:79520035-79520057 AAGAAGAAAAAGAAGAAGGAAGG + Intergenic
910005509 1:82391330-82391352 AAGTGGCCCAAAAAAGAGGATGG + Intergenic
910015327 1:82516919-82516941 AAGTAGAACATAAAGAAGGAAGG + Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910564504 1:88628119-88628141 AAAAAGAAGAAGAAAAAGGAAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912164568 1:107028123-107028145 AAGGAGAAAAAGAAAAAGAAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913128516 1:115815772-115815794 AAGAATAACAAGAAAGGGGAGGG - Intergenic
913193092 1:116430247-116430269 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
913455916 1:119030608-119030630 TAGAAGAAAAAGACAGAGGAAGG + Intergenic
913598632 1:120402568-120402590 AAAGAGAAAAAGAAAGAGAAAGG - Intergenic
913610324 1:120504343-120504365 AAATAGAGCCAGAAACAGGAAGG + Intergenic
913613753 1:120534840-120534862 AGGTAGAACCACAAAAAGGAAGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
913984474 1:143552491-143552513 AAATAGAGCCAGAAACAGGAAGG - Intergenic
914088749 1:144477050-144477072 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
914309863 1:146457153-146457175 AAAGAGAAAAAGAAAGAGAAAGG - Intergenic
914372980 1:147046688-147046710 AGGTAGAACCACAAAAAGGAAGG + Intergenic
914576515 1:148976041-148976063 AGGTAGAACCACAAAAAGGAAGG - Intronic
914580867 1:149017896-149017918 AAATAGAGCCAGAAACAGGAAGG - Intronic
914592246 1:149115980-149116002 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
914844872 1:151277393-151277415 GAGAAGAACAGCAAAGAGGAAGG - Intergenic
914914615 1:151811457-151811479 AATGAGAACAAGAAAGAACATGG + Intronic
914960099 1:152197470-152197492 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
914962899 1:152222120-152222142 AAGTAGGAAGAGAAAGAGAAGGG + Intronic
915061125 1:153186537-153186559 AAATAGAAAAAAAAAGAGCAGGG - Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915585399 1:156841352-156841374 AGGTAGATCAACAATGAGGAAGG + Intronic
915791434 1:158676109-158676131 AGGTAGAGCAATAAAGGGGAGGG + Intronic
915816603 1:158973715-158973737 AAGTGTCAGAAGAAAGAGGAGGG - Exonic
915923474 1:159996741-159996763 AAGAAGAACTAGAAAGAAGGTGG - Intergenic
916152151 1:161804673-161804695 AAGTAGAAAAAAAAAAAGGCAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916374577 1:164138285-164138307 AAGTAACAGAGGAAAGAGGAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916683166 1:167122318-167122340 AAGTAGAGAGAGAAAGAAGAGGG - Intronic
916882336 1:169032026-169032048 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
917009887 1:170458709-170458731 AAGAAGAAAAAGAGAGAGAATGG - Intergenic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917198170 1:172488327-172488349 AACTAGAATAAGAATTAGGAGGG + Intergenic
917289553 1:173458463-173458485 ATGTAGAAAGAGAAAGAGTAGGG + Intergenic
917409380 1:174742214-174742236 AAGAAGAAGAAGAAAGAAAAGGG + Intronic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
917635893 1:176935858-176935880 AAAGAGAGCAAGAAAGAGGGGGG - Intronic
917686328 1:177419766-177419788 AAGGAGAACAGGGCAGAGGAGGG - Intergenic
917811500 1:178662833-178662855 AAGTAGACCAAGCAAGATGTTGG + Intergenic
918157368 1:181862073-181862095 AAGTAAAACAAGAAAGATCAAGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918549987 1:185731384-185731406 AAGAAGTACAAGAAATATGAGGG + Intergenic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918702977 1:187628694-187628716 AAGTAGAAAAAGAAAAAGTTTGG + Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918784748 1:188750933-188750955 CAGTAGAAAAAGGGAGAGGAGGG - Intergenic
918930341 1:190847213-190847235 AAAAAGAAAAAGAAAAAGGAAGG + Intergenic
918974335 1:191462583-191462605 AAGTAGAATAAGGAAGAAGCAGG - Intergenic
918986568 1:191635923-191635945 AATTAAAACAAGTAAGTGGAAGG + Intergenic
919038183 1:192343946-192343968 AAGTTGGAGAAAAAAGAGGATGG - Intronic
919195441 1:194278926-194278948 AGAGAGAACAAGAAAGAGAAAGG + Intergenic
919225572 1:194695555-194695577 AAGTAAAACAAAAAATAGAAAGG + Intergenic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
919519045 1:198564353-198564375 AAATAGAAAAAGGAAGGGGAGGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
919914102 1:202129516-202129538 ATGTGGCACAAGAAAGTGGATGG - Exonic
919974991 1:202604504-202604526 AAGAAGAACAAGAAGGAGAAGGG - Exonic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920764090 1:208814750-208814772 AAGAATAACAAGAAAGAGAAGGG + Intergenic
921211154 1:212899891-212899913 AATTGGAGCAAGAAAGAGGTAGG - Intergenic
921279259 1:213549542-213549564 AAGTAGGGCAAGAAGGAGGCAGG + Intergenic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
922038602 1:221873989-221874011 AATAAAAACAAGAAACAGGAAGG + Intergenic
922117773 1:222631101-222631123 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
922240834 1:223754750-223754772 ACGCAGAACAAGAAAGAGTCTGG + Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922402712 1:225276928-225276950 AATAAGAAGAAGAAAAAGGAAGG + Intronic
922494311 1:226044001-226044023 AAAAAAAAAAAGAAAGAGGAAGG - Intergenic
922522004 1:226261823-226261845 AAGTAGAAGAACAAAGTTGAAGG + Intronic
922548565 1:226476790-226476812 AAGTAGGACAGGAAAGTGCAAGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922682958 1:227616172-227616194 AAGGAATACAAGAAAGAGGTGGG - Intronic
922806035 1:228390120-228390142 AAAGAAAACAATAAAGAGGAAGG + Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923004714 1:230038173-230038195 AAAAAGAAAAAGAAAGAAGAAGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923116852 1:230948482-230948504 AAGAAAAAAAAAAAAGAGGAAGG - Intronic
923307972 1:232705767-232705789 AATTAGAACAGAAAAGAGAAAGG + Intergenic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924668467 1:246098191-246098213 ATCAAGAACAAGAAAGATGATGG + Intronic
924721531 1:246627478-246627500 GAGTAAACCAAGAAACAGGAAGG + Intronic
1062956734 10:1545436-1545458 AAGTAGAACAGAAATGAGAATGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063552519 10:7046421-7046443 AAGTAGGCCAGGAAAGAGGAAGG - Intergenic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064855127 10:19758984-19759006 AAGAAGAAGAAGACAGAGAATGG - Intronic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1065052800 10:21813127-21813149 AAGTAACCCAAGAAAGAGCAAGG - Intronic
1065052805 10:21813260-21813282 AAGTAACCCAAGAAAGAGCAAGG - Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065066148 10:21966991-21967013 AAGAAGAAGAAGAAAAAGGTGGG - Intronic
1065313432 10:24438528-24438550 CAGGAGTACAAGCAAGAGGAGGG - Intronic
1065374865 10:25028500-25028522 AAGTTGAAGAAACAAGAGGAAGG - Intronic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065569302 10:27053341-27053363 AAGAAGAGCAAGAAAGGGAAGGG - Exonic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065900850 10:30206664-30206686 AAGTAGAAGGTGAAAGAGAATGG + Intergenic
1066097983 10:32091590-32091612 ATATAGAACAAAAAAGAGCAGGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066312682 10:34212919-34212941 AAATAGATGAAGAAAGATGAAGG - Intronic
1066334657 10:34463283-34463305 GAACAGAACAAGAAAGGGGAGGG + Intronic
1066534627 10:36378002-36378024 TAGTAGAACACAAAAGAGAAAGG - Intergenic
1066539626 10:36431733-36431755 AAGTAAAACAAAAAATAGTAAGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067767742 10:49100021-49100043 AAAAAGAAAAAGAAAAAGGAAGG + Intronic
1068042759 10:51846993-51847015 AAGTAGATCAAGTAGGAGGCTGG + Intronic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068318696 10:55381770-55381792 AAGTAAAAGAAGAAAAAGAAAGG + Intronic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1068828007 10:61461448-61461470 GAGTAGAACAAAAAAGAAAATGG + Intergenic
1069107145 10:64397191-64397213 AAGTAAAGAAAGAAAGAAGAGGG + Intergenic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069473066 10:68710317-68710339 AAAAAGAAGAAGAAAGAAGAAGG - Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069618053 10:69818767-69818789 GAGTAGAACAAGGTAGAGGAAGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070456763 10:76624771-76624793 GAGTAGGAGAAGAAAGGGGACGG - Intergenic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070568008 10:77618594-77618616 CAGGAGAACAGGAAAGAGCATGG + Intronic
1070572466 10:77650488-77650510 GAGAAGAAAAAGAAAGAGAAGGG + Intergenic
1070606160 10:77899823-77899845 AAAGAGACCATGAAAGAGGAAGG + Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071019742 10:81038473-81038495 AAGTAGACCAAGCAAGCAGAAGG + Intergenic
1071191424 10:83105882-83105904 AAGAAGAAGAAGGAAAAGGAAGG - Intergenic
1071230399 10:83579557-83579579 AAAAAGAACAAGAATGAAGAGGG + Intergenic
1071351414 10:84749815-84749837 AAGCAGAACATAAAAGAGAAGGG + Intergenic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1071728598 10:88224575-88224597 AAGTAGCCCAAGAAAGAAGGAGG - Intergenic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1071923267 10:90375339-90375361 AGGTAGCACAAGACAGAAGAAGG - Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072165597 10:92809750-92809772 AAAAAAAAAAAGAAAGAGGATGG + Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072718697 10:97767821-97767843 AAGGAGATCAAGATAGAGAATGG - Exonic
1073096387 10:100982813-100982835 AAGGCGAGCAAGAAAGAGAAGGG + Intronic
1073124995 10:101143598-101143620 AACTATAAAAAGAAAGAGTATGG + Intergenic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073588637 10:104735095-104735117 AAGCACATCAAGAAAGAGAAGGG + Intronic
1074135166 10:110619579-110619601 GAGTAGGACAAGAAGGAGCATGG + Intergenic
1074300638 10:112230561-112230583 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1074453088 10:113575340-113575362 AAGTAGTTGAAGAAAGATGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074775166 10:116762575-116762597 AAATAAAAAAAGAAAGAGTAAGG - Intergenic
1074953780 10:118367470-118367492 AGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1075284458 10:121171711-121171733 AAAAAGAGAAAGAAAGAGGAAGG + Intergenic
1075908903 10:126106466-126106488 AAGAAGAAGAAGAAAAAGAAGGG - Intronic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1077518573 11:3017293-3017315 AAGCTGAGCAACAAAGAGGAAGG + Exonic
1077599490 11:3564099-3564121 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078080326 11:8199778-8199800 GAGCAGAACAAGGGAGAGGATGG - Intergenic
1078380729 11:10837719-10837741 AAAAAGAACAAGAAAGGGGGAGG - Intronic
1078407578 11:11084049-11084071 AATTGGAAAAAGAAAGAGAAAGG - Intergenic
1078477796 11:11647439-11647461 GAGTAAATCAAGAAAGATGAAGG + Intergenic
1078727502 11:13944767-13944789 AAAAAGAACAAGAAAGAAAAGGG - Intergenic
1079339370 11:19599319-19599341 AAGGAAAACATGAAAAAGGATGG - Intronic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079959083 11:26900506-26900528 AAGAAGTAGAAGAAAGAGGTAGG - Intergenic
1080299062 11:30763959-30763981 AATTAGTACATCAAAGAGGATGG - Intergenic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1081279449 11:41190236-41190258 ACGGAGGACAAGAGAGAGGAAGG + Intronic
1081362341 11:42195968-42195990 AGGGAGAAAAAGAAAGAGAAAGG - Intergenic
1081518516 11:43858331-43858353 AAGCAGAACATAAAAGAGAAGGG - Intergenic
1082277471 11:50237388-50237410 AAATAAAACAAAAAAGAGGCTGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1083177202 11:60957994-60958016 AAAGAGAACAAGAGAGAGAAGGG + Intergenic
1083213247 11:61202550-61202572 AAGGAGCAAAAGAAAGAGAAGGG + Intergenic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084085292 11:66852317-66852339 ACGAAGAACACCAAAGAGGAAGG - Intronic
1084255396 11:67938704-67938726 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084559615 11:69895621-69895643 AAGTAAAACAAGCAAGACAAAGG - Intergenic
1084817353 11:71656591-71656613 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1085008954 11:73122471-73122493 GAGCAGATCAAGAAAGAAGATGG - Intronic
1085654214 11:78297661-78297683 AAGTAGAACAAGCAAAAGGCAGG + Intronic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1085844513 11:80049995-80050017 AAGGAGCATAAGAAAAAGGAAGG + Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086092070 11:83014845-83014867 AAGGAAGAAAAGAAAGAGGAAGG + Intronic
1086140403 11:83492622-83492644 AAGTTGAACAAGACTGAGGGAGG - Intronic
1086198743 11:84174201-84174223 AATTTGAACATGAAATAGGATGG - Intronic
1086217431 11:84400681-84400703 AATTTGAACAAGAAAGGGAAAGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087202282 11:95357805-95357827 AAGTAAACCAAGAAGGAGGAGGG - Intergenic
1087628041 11:100619597-100619619 AGGAAGAACAAGAAAGCAGAAGG - Intergenic
1087845852 11:102971608-102971630 GAATAGAAAAAGAAAGAGGAAGG + Intergenic
1088016214 11:105063437-105063459 AAGTCGAACCCGAAAGAGAAAGG + Intronic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088422637 11:109666162-109666184 AATTGGCAGAAGAAAGAGGAAGG - Intergenic
1088448351 11:109955570-109955592 AAGCAGGACAAAAAGGAGGAGGG + Intergenic
1088500924 11:110481462-110481484 AAGTAGAAAGAGAAAAAGAAAGG + Intergenic
1088993171 11:114972276-114972298 AGGGAGGACATGAAAGAGGAAGG - Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089901321 11:121988795-121988817 AAAAAGAAAAAGAAAGAGAAAGG + Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1090864650 11:130688602-130688624 AAACAGAAAAAGAAAGAGAAAGG + Intronic
1090879737 11:130823159-130823181 AATCAGAACATGAAAGAGGGTGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1092067425 12:5603493-5603515 TGGTAGAAGAAGAAAGAGAAAGG + Intronic
1092069580 12:5621816-5621838 AAGAGGAAGAAGAAAGAGAAGGG + Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092225520 12:6745882-6745904 AAGCAGAATAACACAGAGGAGGG - Intergenic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092425631 12:8373444-8373466 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1092508129 12:9124978-9125000 AGGCAGAGCAAGAGAGAGGATGG + Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092571813 12:9733453-9733475 AAACAGAACAAGAAAAAGAAGGG + Intergenic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092611648 12:10179358-10179380 AAGAAAAACAGGAAAGAAGAGGG + Intronic
1092708726 12:11311484-11311506 AAGAAGAACCAGAAAGAAGGTGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092896366 12:13014805-13014827 AACTAGAGCAAGAAAGACAATGG - Intergenic
1092969546 12:13678982-13679004 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1092969551 12:13679017-13679039 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1093405476 12:18799116-18799138 ATGTAAAACAAGAAAGGGGCAGG + Intergenic
1093482802 12:19622681-19622703 AAGAAGAAAAAGAAAGAAGTGGG - Intronic
1093499791 12:19798727-19798749 AAAGAGAACAAGGAAGAGGGAGG - Intergenic
1093508408 12:19896805-19896827 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1093681927 12:22012378-22012400 AACTAGAACAAGAATAAAGAAGG + Intergenic
1093687024 12:22068398-22068420 AAGAAGAGGAAGAAAGATGAGGG + Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1093818560 12:23582188-23582210 AGGTAGAAGACGAAAGAGAAAGG - Intronic
1093896755 12:24583366-24583388 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094396286 12:30009257-30009279 AAGAAAAAAAAAAAAGAGGAAGG + Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1095043553 12:37472260-37472282 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1095680339 12:44967366-44967388 AAATAAAAAAAGAAAGAGGCAGG + Intergenic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096322369 12:50626382-50626404 AAGAAGAGCAAGAGGGAGGAAGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096778870 12:53980563-53980585 AAGGAAGACAAGAAAGAGAAAGG + Intergenic
1096833016 12:54329270-54329292 AAGTAAAGCAGGAAGGAGGAAGG - Intronic
1096959126 12:55560408-55560430 AACTAGAATAAGAAAAAAGAGGG + Intergenic
1097163672 12:57069275-57069297 AAGGAAAACAAGAAAGAGTTTGG + Exonic
1097341348 12:58441832-58441854 AAGTAAAACAAGACAGAGAGAGG - Intergenic
1097581249 12:61459480-61459502 AAGTATAATAATAAAAAGGAAGG + Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097765612 12:63523390-63523412 AAAGAGAACAAGAAAGAGAGTGG + Intergenic
1097892241 12:64789161-64789183 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1098038595 12:66332299-66332321 AATGGGAACAAGAAAGGGGAGGG - Intronic
1098428168 12:70389831-70389853 AAATAAATTAAGAAAGAGGAAGG - Intronic
1098453733 12:70649439-70649461 GAGTAGAAAAGGATAGAGGAAGG + Intronic
1098458402 12:70703031-70703053 CAGTAGAAAAAAAAAAAGGAAGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098695550 12:73549690-73549712 AAGTATATCGAGAAAAAGGAAGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098980531 12:76951107-76951129 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1099040820 12:77652373-77652395 AAGTAGTACAATAAAGAGAAAGG - Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099571121 12:84320173-84320195 AAAAAGAAAAAGAAAAAGGAAGG - Intergenic
1099595278 12:84655063-84655085 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1099611005 12:84869670-84869692 AAGTTGAATTGGAAAGAGGAAGG - Intronic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100257545 12:92899751-92899773 AATGAGAACGAGCAAGAGGAAGG - Intronic
1100347554 12:93747443-93747465 AAGAAGAAAAATTAAGAGGAAGG - Intronic
1100438462 12:94593412-94593434 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100767397 12:97882649-97882671 AAGGAAAACAAAAAAGAGCAAGG - Intergenic
1101109681 12:101473518-101473540 AAGTTGGAGAAGAAAGAGGCAGG - Intergenic
1101245066 12:102877383-102877405 AAGTAGAGAAGGTAAGAGGAAGG + Intronic
1101270252 12:103135471-103135493 AAAAAGAAAAAGAAAGAGAAAGG + Intergenic
1101430784 12:104625297-104625319 AAAAAGAAAAAGAAAAAGGATGG - Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101839306 12:108316492-108316514 AAGTGGCAGAAGAAAGACGAAGG + Intronic
1101900014 12:108784937-108784959 AAGTGGCACAGGAAAGAGGCAGG - Exonic
1101976092 12:109360093-109360115 AAGAAGAAAAAGAAAAAAGAAGG - Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102523866 12:113496954-113496976 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102669198 12:114602632-114602654 AAGGAAAAAAAGAAAAAGGAGGG + Intergenic
1102702373 12:114850560-114850582 ATCTAGACCAAAAAAGAGGAGGG - Intergenic
1102749171 12:115277248-115277270 AAGAAGAAAAAGAAGAAGGACGG + Intergenic
1102801929 12:115742784-115742806 AAACAGAACAAGAGAGAGGGAGG - Intergenic
1102841610 12:116130891-116130913 AACTAGAAAAATAAACAGGAAGG + Intronic
1102925809 12:116825270-116825292 AGGGAGAACAAGCAAAAGGAAGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1102984337 12:117266093-117266115 AAATAGAAAAAGAAAAAGGCCGG - Intronic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103168252 12:118789596-118789618 AAGAAAAAAAAGAAAGAGAAAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1104184189 12:126413266-126413288 AAGAAGAAAAGGAAAGTGGAAGG + Intergenic
1104236300 12:126940998-126941020 AAGTAGTGCAAAAAAGAAGATGG + Intergenic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104710835 12:130984775-130984797 AAGAAGGAAAAGAGAGAGGAGGG - Intronic
1105061358 12:133154001-133154023 AGGTAGTACCAGAAATAGGATGG - Intronic
1105221990 13:18338918-18338940 AAAAAGAAAAAAAAAGAGGAAGG - Intergenic
1105546351 13:21353548-21353570 AAATAAAGAAAGAAAGAGGAAGG - Intergenic
1105617859 13:22036829-22036851 AAGCAGAAAAAAAAAAAGGATGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106075363 13:26456238-26456260 AAAAAGAAAAACAAAGAGGATGG + Intergenic
1106295748 13:28412284-28412306 AAAGAGAAAAAGAAAGAGAAGGG - Intronic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1106407342 13:29485355-29485377 TACTATGACAAGAAAGAGGATGG + Intronic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1106885564 13:34181203-34181225 AAGGAAAAGAAGAAAGAGAAAGG - Intergenic
1107047326 13:36007554-36007576 AAGAAGAGCAACAAACAGGAAGG + Intronic
1107405749 13:40111164-40111186 GAGTAGAACAAGAGAAACGAGGG + Intergenic
1107529707 13:41271542-41271564 AACTAAAACATGAAAGACGATGG - Intergenic
1107586758 13:41857937-41857959 GAGTAGAACAAAAAGGAGAAAGG + Intronic
1107620513 13:42224324-42224346 AAGATGGACAAAAAAGAGGAAGG - Intronic
1108026905 13:46187511-46187533 AAGTAGACAAAGAAAGTGGATGG - Intronic
1108037816 13:46310024-46310046 GAGTAAGCCAAGAAAGAGGAAGG - Intergenic
1108170184 13:47733440-47733462 AAGTAGAAATAGAAACAGAATGG + Intergenic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108861253 13:54862230-54862252 AAGAAGAGCAAGTAAGGGGAAGG + Intergenic
1108900403 13:55397591-55397613 AAGTAGACAAGGAAAGAGAATGG - Intergenic
1109428534 13:62200244-62200266 AACAAGAACAAAAAAGAGGATGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110327282 13:74231285-74231307 AACTAAGAGAAGAAAGAGGAGGG + Intergenic
1110398581 13:75063024-75063046 AAGTAAGGAAAGAAAGAGGAAGG + Intergenic
1110428155 13:75392610-75392632 AAGTAGGACGAGGAGGAGGAGGG - Intronic
1110502643 13:76246725-76246747 AAGAAGAAGAAGAAAAAGAAGGG - Intergenic
1110865991 13:80397102-80397124 AAGGAGAACAAGAAGAAAGAAGG + Intergenic
1111004994 13:82236015-82236037 AACTAGAAGTAGAAAGAGCATGG - Intergenic
1111044458 13:82796543-82796565 AAGAAAAACAAGGAAGAGGTAGG + Intergenic
1111245453 13:85532712-85532734 AAGAAGAAAATGAAAGAGCAAGG + Intergenic
1111591990 13:90360110-90360132 AAGTAGAAGAACAAAGAGTGAGG + Intergenic
1111893100 13:94107548-94107570 AAATAGAAAAAGAAAAAGGTTGG - Intronic
1112170277 13:96965869-96965891 AATGAAATCAAGAAAGAGGAGGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112469686 13:99676245-99676267 AAATAGAAAAAGAAAAAGAAAGG - Intronic
1112534532 13:100238450-100238472 AAGAAGGACAGGAAAGAGAAAGG - Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1113053056 13:106236262-106236284 AAGAAGAAGAAGAAAAAGAAAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113490241 13:110686015-110686037 AAAGAAAAAAAGAAAGAGGAGGG + Intronic
1113659351 13:112094986-112095008 AAGAAGAACAAGAGAAGGGAAGG - Intergenic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114042542 14:18692373-18692395 AACCAGGACGAGAAAGAGGAGGG + Intergenic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1114994644 14:28332673-28332695 AAGAAGAATAAGAAAGACAAAGG + Intergenic
1115018529 14:28646379-28646401 AAGAAGAAGAAGAAAGGAGAAGG + Intergenic
1115048789 14:29030223-29030245 AATTAGAACAAGAGATAAGATGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115183483 14:30656799-30656821 AATTAGAGCAAGAAAGAACAGGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115360544 14:32495685-32495707 AAATAAAACAGAAAAGAGGAAGG - Intronic
1115383718 14:32770748-32770770 AAGTATAATATCAAAGAGGAAGG - Intronic
1115536730 14:34380027-34380049 AAGTAGAAAAAGAGAGAGAGGGG + Intronic
1115725441 14:36210550-36210572 ATGTAGAGTAAGAAAGAGAAGGG + Intergenic
1115941395 14:38614246-38614268 AAAAAGAACTAGAAAGGGGAGGG + Intergenic
1116083665 14:40206799-40206821 AAGTAGAAACAGAAAGTGTAGGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1117087743 14:52219010-52219032 AAAAAGAAAAAGAAAGAAGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117396726 14:55317983-55318005 AAGTAGAAGATAAAACAGGAGGG - Intronic
1117680109 14:58195176-58195198 AAATAGAACCAGAAAGGGCACGG + Intronic
1118208955 14:63749200-63749222 AAATAGATAAAGAAAGAGAAAGG - Intergenic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118559045 14:67057686-67057708 AACAAGAAAGAGAAAGAGGAAGG - Intronic
1118983081 14:70731741-70731763 GAGTATAACAAAAAACAGGAGGG + Intronic
1119324892 14:73753951-73753973 AAGAAGAGCAATAAAGGGGAAGG + Intronic
1119496850 14:75087028-75087050 AAGTTGAACAAGAAATTAGAAGG - Exonic
1119722331 14:76899642-76899664 AGCTAGAACAAGAGTGAGGAGGG + Intergenic
1119752043 14:77085708-77085730 AAGTAGACAAAGAAAGACAAGGG + Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120055475 14:79919124-79919146 AAATAAAAGAAGAAAGAAGAAGG + Intergenic
1120106589 14:80502279-80502301 GAGTGAAACAAGAAAGAGGAAGG + Intronic
1120147411 14:80994042-80994064 AAGGAGGAAAAGGAAGAGGAGGG - Intronic
1120182202 14:81355186-81355208 AAGAAGGAGAAGAAAGAGAAAGG + Intronic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120719076 14:87870902-87870924 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1121070261 14:91012986-91013008 AAGTAGAGCAAACAAGGGGATGG - Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121844946 14:97164706-97164728 AAGCTGAACAAGAAAGTGAAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1123188995 14:106549998-106550020 CAGGAGAACAGCAAAGAGGAAGG - Intergenic
1202846868 14_GL000009v2_random:185761-185783 AAGTATAACAAAAAAAAGAAGGG + Intergenic
1202916325 14_GL000194v1_random:176362-176384 AAGTATAACAAAAAAAAGAAGGG + Intergenic
1202942090 14_KI270725v1_random:159853-159875 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1123956323 15:25339100-25339122 AAATAAAACAAAAAAAAGGAAGG - Exonic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1125049735 15:35283047-35283069 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125581075 15:40786263-40786285 CAGAAGAACAAGAAATAGAAGGG + Intronic
1125621154 15:41063391-41063413 AAGTAGAAAAACAATTAGGAAGG + Intronic
1125682643 15:41541876-41541898 AAGTAGATGAAGAAAAAGTAAGG - Intronic
1125704131 15:41716457-41716479 AAAAAGAAAAAGAAAAAGGAGGG + Intronic
1125826091 15:42677843-42677865 CAGGAGGACAAGAAAGAGAAAGG - Intronic
1125848139 15:42877497-42877519 AAAAAGAGCAATAAAGAGGAAGG + Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1127091039 15:55467677-55467699 CAGTAGAAAAGGAAATAGGAAGG + Intronic
1127122110 15:55780612-55780634 AAGAAGGACAGGAAGGAGGAGGG + Intergenic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127517824 15:59713424-59713446 AAAAAGAAAAAGAAAAAGGAAGG - Intergenic
1127693153 15:61417554-61417576 AAGTATAACTAGGAACAGGAAGG + Intergenic
1128095622 15:64952357-64952379 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095772 15:64954055-64954077 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
1128095837 15:64954743-64954765 AAGAACAAAAAGAAAGAAGAAGG - Intronic
1128120892 15:65145303-65145325 ACATGTAACAAGAAAGAGGAGGG - Intergenic
1128174368 15:65541812-65541834 AGCTATAACAAGAAAGAGTAAGG + Intronic
1128763064 15:70231850-70231872 AATTAGAACAAGAAATCAGAGGG - Intergenic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129220871 15:74131007-74131029 AAGTAGACCAAGCAGGAGGCGGG + Intronic
1129635000 15:77306203-77306225 AAGTATATTAAGAAAGATGATGG + Intronic
1129855431 15:78821304-78821326 AAGTAAGTCAAGAAAGAGAAAGG + Intronic
1130226001 15:82058842-82058864 GAGTAGAGAAAGGAAGAGGAGGG - Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130892287 15:88143235-88143257 AAATAGAAAAAGAAAGAAGGTGG + Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131880532 15:96857616-96857638 AAAAAGAACAAGAAAAAGAAAGG + Intergenic
1132032615 15:98450810-98450832 ACCTGAAACAAGAAAGAGGAGGG + Intronic
1132212125 15:100031931-100031953 AAGAGGAACAAGAAAAAGAAAGG + Intronic
1132220293 15:100100256-100100278 GAGTCGAAGAAGCAAGAGGAGGG - Intronic
1132510730 16:340022-340044 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1133014980 16:2935496-2935518 AAGAAAACCAAGAAAGAGAAAGG - Intronic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133250821 16:4479707-4479729 AAATAGAATAAGAAAAAGGCAGG - Intronic
1133372707 16:5257471-5257493 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1133647206 16:7775433-7775455 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
1133756057 16:8763376-8763398 AAGCAGAAAAAGCAAGAGGTAGG + Intronic
1133885358 16:9822454-9822476 GAGTAGGAAAAGAAAGAGAAGGG + Intronic
1134001538 16:10786812-10786834 AAGTAGAAGAAGAAAGAAATCGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134573606 16:15313303-15313325 AAGAAGAAAAAGAAAAAGAAAGG + Intergenic
1134694600 16:16214286-16214308 AAGTGGAACAGGAATGAGGTTGG + Intronic
1134728820 16:16443013-16443035 AAGAAGAAAAAGAAAAAGAAAGG - Intergenic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1134938623 16:18268911-18268933 AAGAAGAAAAAGAAAAAGAAAGG + Intergenic
1134977236 16:18580351-18580373 AAGTGGAACAGGAATGAGGTTGG - Intergenic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135779027 16:25282716-25282738 AAGTGGACCATGATAGAGGAAGG - Intergenic
1135876970 16:26211198-26211220 AAGTAGCAAAAGGAATAGGAAGG - Intergenic
1135980179 16:27141225-27141247 AAATAGAATAAACAAGAGGAAGG - Intergenic
1136104313 16:28018627-28018649 AAGAATAACAAGAAAGAAGAGGG + Intronic
1136178563 16:28535282-28535304 AAGGAGGGAAAGAAAGAGGAAGG - Intronic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137656559 16:50164289-50164311 AAGAACAACAACAAACAGGATGG - Intronic
1137675658 16:50302575-50302597 AAGTTAAACAAAAAAGAGGGTGG - Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139044515 16:63040400-63040422 AAGAAGGACAGGAAAGAAGAAGG + Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139580486 16:67870750-67870772 AAGGGGATCAAGAAACAGGAAGG - Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139751846 16:69113703-69113725 AAGAAGAGCAAGAAAGGGGTTGG - Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1139869606 16:70095691-70095713 AAATCAAACAAGCAAGAGGAGGG - Intergenic
1140282633 16:73568591-73568613 CAGTTGGACAAGAAAGGGGAAGG + Intergenic
1140385781 16:74536529-74536551 AAATCAAACAAGCAAGAGGAGGG + Intronic
1140550956 16:75865091-75865113 AAAAAGAAAAAGAAAAAGGAGGG - Intergenic
1140731212 16:77858287-77858309 GATTGGAAGAAGAAAGAGGAAGG + Intronic
1140777663 16:78264902-78264924 AAGGAGAAAAAGAAAAAGAAAGG - Intronic
1140834706 16:78782321-78782343 AAGTAGGAAAACAGAGAGGATGG - Intronic
1141071889 16:80964306-80964328 AAGTAGCATAAAAAAGAAGAGGG - Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141478103 16:84287449-84287471 AATTAAAAAAAAAAAGAGGAAGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141781240 16:86162925-86162947 GAGTAGAACAAAAAGGTGGAAGG - Intergenic
1141789279 16:86223083-86223105 AATTAGAAAAAGCAAGAGGCTGG - Intergenic
1142241555 16:88949569-88949591 AAAAAGAAAAAGAAAGAAGATGG + Intronic
1142588430 17:988980-989002 ACGTAGCACAAGAGAAAGGAGGG + Intergenic
1142705706 17:1692639-1692661 AAGAAGAACTAAAAAGAGGTGGG - Intergenic
1143182546 17:4992673-4992695 AAGGAGAGAAAGAAAGAGAATGG - Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143715705 17:8767205-8767227 AAGGAGAAAAAGAAAATGGATGG - Intergenic
1143794681 17:9327172-9327194 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144091420 17:11860345-11860367 AAGCAGAATAAGAGAGAGAAAGG - Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146429808 17:32781680-32781702 AAGGAGAGAAATAAAGAGGAAGG + Intronic
1146495111 17:33314858-33314880 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1146597343 17:34181713-34181735 AAGAAGAAGAAGAGAGAGAAAGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147228244 17:38997708-38997730 AAAAAGAAAAAGAAAGGGGAGGG - Intergenic
1148339226 17:46863513-46863535 GAGAAGACAAAGAAAGAGGATGG + Intronic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149008587 17:51831608-51831630 AAGGAAAACAAAAAAGAGGAAGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149299822 17:55294773-55294795 AACAAGAACAAGAAAGAGGATGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149914082 17:60592428-60592450 AAGTTGAAAAAGAAAAAAGAAGG + Intergenic
1150175360 17:63049109-63049131 AAGTAAAACAAGAGAAAGAAGGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150502027 17:65660231-65660253 AAAGAAAACAAAAAAGAGGAAGG - Intronic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150731004 17:67693853-67693875 GAGTAAAACAAGGAAGGGGATGG - Intronic
1150888425 17:69114753-69114775 AAGTGGAACAAGAGGTAGGAGGG - Exonic
1151133300 17:71920930-71920952 AAAAAGAAGAAGAAAGAGTAGGG + Intergenic
1151228233 17:72662444-72662466 AAGAAAAAAAAGAAAAAGGAAGG + Intronic
1151484573 17:74390407-74390429 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1151921948 17:77163493-77163515 AAGTATAAAACCAAAGAGGAGGG - Intronic
1151938558 17:77279342-77279364 AAGAAGGACAAGAGAGAGGGAGG - Intergenic
1151947537 17:77327730-77327752 ATTTAGAAAAAAAAAGAGGAGGG - Intronic
1153096542 18:1412575-1412597 TAGTGGAACACGAAAGATGAAGG + Intergenic
1153166462 18:2267188-2267210 AGGCAGAACAAGAAGGAGGGAGG + Intergenic
1153210503 18:2758219-2758241 AAGGAAAACAGGAAAGAGAAGGG - Intronic
1153645609 18:7193401-7193423 AAGAAAAAAAAGAAACAGGATGG - Intergenic
1153717247 18:7862612-7862634 AAGTAAAATGGGAAAGAGGAAGG + Intronic
1153928147 18:9853872-9853894 AATTAAAAAAAGAAAGAGAAAGG + Intronic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1155600953 18:27546879-27546901 AAGAAGAAAAGGAGAGAGGAAGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155776711 18:29772562-29772584 CAGAAGAACAAGAAAGCAGATGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155989131 18:32260971-32260993 AAGTAGCTCAAGAAAGATAAAGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156100542 18:33588970-33588992 GAGTAGAAGAAAAAAGATGAAGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156611610 18:38731469-38731491 GAGTAGAGCAAGAAAGAGAGAGG - Intergenic
1156666810 18:39418544-39418566 AAGCAGAAGAAGAAAAAGAAGGG + Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1156695711 18:39763994-39764016 AATTACAACATGAAAGAGGAAGG + Intergenic
1156738015 18:40286692-40286714 AAGTAGAACTTGAAATAGGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157214684 18:45773115-45773137 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157768670 18:50325161-50325183 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1158039809 18:53079277-53079299 AAGTATAACAAGAAAGCAGGTGG - Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158243606 18:55405747-55405769 AGGTAGGAAAAGAAAGAGGCAGG + Intronic
1158296479 18:56002538-56002560 AAAAAGAAAAAGAAAAAGGAGGG - Intergenic
1158313547 18:56185491-56185513 AGGTAGAATAAAAAAGAGAAAGG + Intergenic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158611100 18:58941849-58941871 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1158965833 18:62621584-62621606 AAGTAGAAAAAGAGCCAGGAAGG + Intergenic
1159126058 18:64226083-64226105 AAGTAGAAATAGAAAGAAAACGG + Intergenic
1159317326 18:66793173-66793195 AATTAGATAAAGAAAGAGAAGGG - Intergenic
1159473257 18:68883469-68883491 AAGAAGAACAGAAAATAGGAGGG + Intronic
1159516585 18:69466764-69466786 AAGTAGGAAAAGTAAGAGGGAGG + Intronic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161705262 19:5817526-5817548 AGGAAGAAAAAGAAAGAGAAAGG + Intergenic
1161859341 19:6786030-6786052 AAATAAAACATGAAAGAGAATGG - Intronic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162011026 19:7815253-7815275 AAGAAGAATAAGGAACAGGATGG - Intergenic
1162056895 19:8069959-8069981 AAGTAGATCAAGACAGAGAAGGG - Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1162874826 19:13613286-13613308 AGAGAGAACAAGAGAGAGGAGGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163276090 19:16285230-16285252 AAGAGGAAGAAGAAAGAGAAGGG + Intergenic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1166103519 19:40585834-40585856 AAGTGAAATAAGAAAGAGGCCGG - Intronic
1166621803 19:44307746-44307768 GAGGAGAACAAGGAAGAGAAGGG + Intergenic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1167247905 19:48384873-48384895 AAAAAGAAAAAGAAAAAGGAAGG - Intronic
1167253272 19:48412833-48412855 AAAAAAAAAAAGAAAGAGGAGGG + Intronic
1167429136 19:49444231-49444253 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1167429147 19:49444309-49444331 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1168098299 19:54127926-54127948 AAGAAGAAAAAGAAAGGGGGTGG + Intronic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
925221980 2:2149123-2149145 AAAAAGAACAAAAGAGAGGAAGG - Intronic
925496186 2:4452221-4452243 AAGAAGAACAAGAGGAAGGAAGG - Intergenic
925618597 2:5768314-5768336 CAATAGAATTAGAAAGAGGAGGG - Intergenic
926923162 2:17959449-17959471 AAGAAGAAGAAGAAAAAGAATGG - Intronic
927009134 2:18883380-18883402 AAGTAAAACAAGAAAGTTAATGG + Intergenic
927175859 2:20406977-20406999 AAAAAGAAAAAGAAAAAGGAAGG - Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
927424566 2:22967866-22967888 GAAATGAACAAGAAAGAGGAAGG - Intergenic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
927761696 2:25762367-25762389 AAGAAGAGTAAGAAAGAGGCTGG + Intronic
928057746 2:28074969-28074991 ATATAGACCAAGAAAAAGGAGGG + Intronic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928538484 2:32262361-32262383 AAGAGGAAGAAGATAGAGGAAGG + Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
928746750 2:34424904-34424926 AGGTAGAATAGGAAAGAGAAAGG + Intergenic
928851007 2:35746499-35746521 AAGTTCAACAAGAAAAAAGAAGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929074273 2:38065383-38065405 AAAAAGAAAAAGAAAGAGGCTGG + Intronic
929648434 2:43653548-43653570 AAGTAAACCAAGAACGAGGAAGG + Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929895368 2:45955410-45955432 AAGTAGAACCAGACAGTGCAGGG + Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930207517 2:48602770-48602792 GAGTAGAAGAAAAAAGAGAATGG + Intronic
930249923 2:49023706-49023728 AAATAAAACAGGAGAGAGGACGG + Intronic
930303159 2:49642881-49642903 AAGTGGAACAAGAAAAAGCTTGG - Intergenic
930485798 2:52009053-52009075 AAATAGAGCTAGAAAGTGGAAGG - Intergenic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930542271 2:52721495-52721517 AAGAAGAATAAGGAAGAGCAAGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
931115168 2:59158331-59158353 AAGAAACAAAAGAAAGAGGAAGG + Intergenic
931203982 2:60129189-60129211 TAGTTGAACAGGAAAGGGGAGGG + Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931733039 2:65170000-65170022 AAGAAGAAAAAGAAAGATAAAGG + Intergenic
931841990 2:66161250-66161272 AAGAAGAACAACAAAAAGAATGG + Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932128686 2:69168218-69168240 AAATACAACAAGAAAGGGAAAGG + Intronic
932170215 2:69548545-69548567 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
932215723 2:69964725-69964747 AAGCAGGACAATAAACAGGAAGG + Intergenic
932383989 2:71313681-71313703 GAGTAGGAAAAGAAAGAGAAAGG - Intronic
932439632 2:71725135-71725157 AAGTAAACCAAGGAAGAGAAAGG + Intergenic
932757773 2:74420752-74420774 AAGAAGAAGAAGAAAGAAAACGG - Intronic
933005646 2:76990469-76990491 ATGGAAAACAAGAAAGAGCAGGG + Intronic
933204725 2:79493201-79493223 AAGTAGAAAGAAAAACAGGAGGG + Intronic
933248021 2:79997371-79997393 AAGAAGAAAAAGAAAAAGAAGGG + Intronic
933374312 2:81459939-81459961 AAGTAGATCATGAAAGAAAATGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933769878 2:85736702-85736724 AAGTGGTCCAAGAAAGAGCAGGG - Intergenic
933855698 2:86412150-86412172 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935418188 2:102840600-102840622 AATTAAAACAAAAATGAGGAAGG + Intronic
935505603 2:103898374-103898396 AAGTAGAAAGAGAAAGAAGGAGG + Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936034557 2:109100525-109100547 GAATAAACCAAGAAAGAGGAAGG + Intergenic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936290528 2:111220377-111220399 AAGGAGACCAAGGAACAGGATGG - Intergenic
936475808 2:112838680-112838702 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
936727947 2:115344921-115344943 AAGTAGAGTAAGAGAGAGGAAGG - Intronic
936731293 2:115384447-115384469 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
939050419 2:137300786-137300808 ATATAGGACAAGAAAGAGAATGG + Intronic
939098288 2:137862872-137862894 AAGATGCAAAAGAAAGAGGAGGG + Intergenic
939160674 2:138584783-138584805 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939507435 2:143064930-143064952 TAATAGAACAAAAAAGAGCAGGG + Intergenic
939642706 2:144660181-144660203 AAGCAGCACAAGAGAGAGGAAGG - Intergenic
939698585 2:145359999-145360021 AGGTAAAGCAAGGAAGAGGAAGG + Intergenic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
939953694 2:148506600-148506622 GAGTAGTACAAGAAATAGAAGGG - Intronic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940492218 2:154377391-154377413 AAGAAAGAAAAGAAAGAGGATGG + Intronic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
941006505 2:160252525-160252547 AAGGAGAACTCTAAAGAGGAAGG + Intronic
941012988 2:160322434-160322456 AGGGATAACAAGACAGAGGATGG + Intronic
941067387 2:160919005-160919027 AAGTCAAACAAAAAGGAGGATGG + Intergenic
941112592 2:161432050-161432072 AAGTACAACAAAAGAGAGCAGGG - Intronic
941320648 2:164049987-164050009 AAGTAGAAAAATAAACAGAAAGG + Intergenic
941373411 2:164696602-164696624 AAGTAGTGCAAGGGAGAGGAAGG - Intronic
941471677 2:165896271-165896293 AAAGAGAAAAAGAAAGAGGTGGG - Intronic
941535434 2:166717517-166717539 AAGAAGAATAAGATAGAGAAAGG - Intergenic
941757723 2:169205995-169206017 AAATATAACAAGGAAGATGATGG + Intronic
941788563 2:169525087-169525109 AAACAGAACAATAAAGGGGAAGG + Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942248895 2:174031411-174031433 AAAAAGAACAAAACAGAGGAGGG + Intergenic
942406757 2:175664047-175664069 AAATAGAACAGGACAGAGGGTGG + Intergenic
942856308 2:180553594-180553616 AACTAGGACAAGAAAGGTGAAGG - Intergenic
942867790 2:180697368-180697390 AAATAAGAGAAGAAAGAGGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943307678 2:186285283-186285305 AAGGTGAACAAGAATGTGGAAGG - Intergenic
943316002 2:186388191-186388213 AGGTAGAGCAAGAAAGAAAAAGG - Intergenic
943569643 2:189558447-189558469 AAGGAGAACAAGAAAGAACTGGG - Intergenic
943780965 2:191823286-191823308 AACAAAAACAAAAAAGAGGAAGG + Intergenic
943958168 2:194220834-194220856 TAGCAGAAAAAGAAACAGGAGGG - Intergenic
944280996 2:197897197-197897219 AAGAGGAAGAAGAAAGAAGAAGG - Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944386651 2:199172543-199172565 AACTAGTACTAGAAAGAGCAGGG + Intergenic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
945274225 2:207972217-207972239 AAGTAGAACTAGCAAGTGTAAGG + Intronic
945786781 2:214249399-214249421 AAGAAGGAGAAGGAAGAGGAGGG + Intronic
945815530 2:214601049-214601071 AAGTAGACCGAGAAACAGAAGGG - Intergenic
945859464 2:215104249-215104271 AAGTAGAAAAATTAAGAGTAAGG - Intronic
946042752 2:216796545-216796567 AAGTAGCAGAAGAAAGACGATGG + Intergenic
946076374 2:217076986-217077008 AGGTTGAACTAGAAAGAAGATGG - Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946483760 2:220081166-220081188 AAATACAAAAAGGAAGAGGAAGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946997582 2:225412643-225412665 TAGTAGAAAAAGAAACAGAAAGG + Intronic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947559479 2:231134840-231134862 AAGTGGAACAGGAAAGAGCTTGG + Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947662914 2:231883198-231883220 AATTAGAAAATAAAAGAGGAGGG - Intergenic
947909204 2:233790541-233790563 AAGGAGAAAAAGAAAGGGGGAGG - Intronic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169248373 20:4041806-4041828 AAGTAGGAAAACAAAGAAGAAGG - Intergenic
1169369524 20:5017954-5017976 AAGTAGAATAGGAAAGGAGAAGG + Intergenic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169850280 20:10041453-10041475 AAGTAGCAGAGGTAAGAGGAAGG - Intronic
1169863380 20:10174334-10174356 AAGTGGACCAAGAAAGAGTGGGG - Intergenic
1169936719 20:10891600-10891622 AAAAAGGAAAAGAAAGAGGAAGG - Intergenic
1170056781 20:12214171-12214193 AAGAAGCACAAGGAAGAAGAAGG + Intergenic
1170101498 20:12705408-12705430 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1170371127 20:15649136-15649158 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1170532648 20:17309898-17309920 AAGAAGAAGAAGAAAGGGAAGGG + Intronic
1170966671 20:21078917-21078939 AAAGAGGAAAAGAAAGAGGATGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171108018 20:22454506-22454528 AAGTAAAACAAAAAACAGAAAGG - Intergenic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1172139604 20:32713026-32713048 AAATTAAAAAAGAAAGAGGACGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172905243 20:38364276-38364298 AAGTAGGGGAAGAAGGAGGAGGG - Intronic
1173931707 20:46826354-46826376 AAGCAGAAGAACAAACAGGAGGG + Intergenic
1174011660 20:47454639-47454661 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1174317242 20:49713012-49713034 AAGTAGAGGAAGAAAGGGGAGGG + Intronic
1174769828 20:53288761-53288783 AAGAAGAGCAATAGAGAGGAAGG + Intronic
1174821512 20:53730434-53730456 AACTACAACAAAAAAGAGGGAGG - Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1174952015 20:55052564-55052586 AAGTGGAACAAAAATGAGCAAGG + Intergenic
1175035828 20:56000969-56000991 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1175085742 20:56457130-56457152 AAGTTAGACAAGGAAGAGGAAGG - Intronic
1175438637 20:58974000-58974022 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1176266782 20:64213513-64213535 AACTAGAGGAAGGAAGAGGAGGG - Exonic
1176581080 21:8527077-8527099 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1176635678 21:9191008-9191030 AAGTATAACAAAAAAAAGAAGGG + Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177657810 21:24041861-24041883 AAAGAGATCAAGAGAGAGGATGG - Intergenic
1177963259 21:27695405-27695427 AAGAAAAAAAAGAGAGAGGAAGG - Intergenic
1178083484 21:29089915-29089937 AAGGAGAATAAGAAAGAAGGAGG + Intronic
1178198327 21:30374352-30374374 AAAAAGAAAAAGAAAGAGGGAGG - Intronic
1178237032 21:30854898-30854920 AAGTAGAACAAAAATAAAGAAGG + Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178323317 21:31622783-31622805 AAAGAAAAAAAGAAAGAGGAAGG - Intergenic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179592332 21:42417041-42417063 AAATTGCACAAGAAAGAGAATGG - Intronic
1179929673 21:44558871-44558893 AACAACAACAAGGAAGAGGAAGG - Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180525454 22:16254901-16254923 AGGAAGAAAAGGAAAGAGGAAGG + Intergenic
1180739846 22:18045443-18045465 AAGTAAAGAAAGAGAGAGGAAGG - Intergenic
1181720228 22:24768582-24768604 AAGGAAAACAAGAAGCAGGAAGG + Intronic
1181785941 22:25227235-25227257 AAATAGTACATTAAAGAGGAAGG - Intronic
1181818130 22:25455094-25455116 AAATAGTACATTAAAGAGGAAGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182243090 22:28932935-28932957 AGGTAGAAGAAGGGAGAGGAAGG - Intronic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182547379 22:31084105-31084127 AAGAGGAACAAGAAAGGGGATGG - Intronic
1183058622 22:35321934-35321956 AAGGAGGACAAGAAAAAGGGTGG - Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183177190 22:36232853-36232875 AAGTGGAACAAGCAAGAGAGGGG - Intronic
1183519587 22:38289053-38289075 AAATAAACCAAAAAAGAGGAGGG + Intergenic
1183643664 22:39109264-39109286 AAAAAGAAAAAAAAAGAGGAGGG + Intergenic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183821935 22:40353303-40353325 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184177400 22:42796005-42796027 AAGAAAAAAAAAAAAGAGGAAGG - Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184345969 22:43913155-43913177 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345972 22:43913239-43913261 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185355574 22:50367580-50367602 AAGTAGAAAATGAAAAAGGGAGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949142860 3:655892-655914 AAGCAGAAGAAGCAAAAGGAAGG - Intergenic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949270595 3:2211967-2211989 AAGGAAAAAAAGAAAGAGAAAGG - Intronic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949644886 3:6081962-6081984 AAGAAGAACAGGAAAGGGAAAGG - Intergenic
949754592 3:7394180-7394202 AGTTAGGACAAGAGAGAGGAAGG - Intronic
949828791 3:8191614-8191636 AAGAGGAAGAAGAAAGAAGAAGG - Intergenic
949828793 3:8191640-8191662 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
950281047 3:11708362-11708384 AATTAGACCCAGAAAGAGCAGGG + Intronic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950576522 3:13835334-13835356 AGGTAGAACCAGAGAGAGAACGG + Intronic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
950751135 3:15129043-15129065 AGGCAGAACAAGGAAAAGGATGG - Intergenic
950795946 3:15510801-15510823 AAAGAGACCAAGAGAGAGGAAGG + Intronic
950845546 3:16012086-16012108 AAGAAGGAAAAGAAAGAGGGAGG + Intergenic
950918609 3:16670099-16670121 AAGCAGAAGAAGAAAAAGAAGGG + Intronic
950975585 3:17239459-17239481 AAGTAGAGGAAGAAATGGGATGG - Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951064288 3:18246407-18246429 AAGCAGAACAAGAGAGGAGATGG - Intronic
951193515 3:19798440-19798462 AACTACAGAAAGAAAGAGGAAGG + Intergenic
951773902 3:26287412-26287434 GAGTAGAAATAGAAATAGGAGGG + Intergenic
952045425 3:29313257-29313279 ATGCACAACAAGAAAGAGGTAGG + Intronic
952344475 3:32471027-32471049 AAGAAGAAGAAGATAGAAGAAGG + Intronic
952433298 3:33247129-33247151 AAGAAAGAAAAGAAAGAGGAAGG - Intergenic
952503078 3:33982291-33982313 GAGTAGGCCAAGAAAGAGGAAGG - Intergenic
952552047 3:34490075-34490097 AAGTAGAATAAGGCAGGGGAAGG + Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
953643781 3:44734242-44734264 AGGCTGAACAAGGAAGAGGAAGG + Exonic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954338977 3:49938315-49938337 AAAAAGAAAAAGAAAGAGGTTGG - Intergenic
954350162 3:50036709-50036731 AAGTAGAACAAAAAGGATTAGGG + Intronic
954733069 3:52681827-52681849 AAGAAGAACAAGGCAGAGAAGGG + Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955018357 3:55093797-55093819 AAGTAGATCTAGAAATAGAAAGG - Intergenic
955077562 3:55628149-55628171 AGGTTAAACAAGAAAAAGGAAGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955352196 3:58202069-58202091 AATTAAAAAAAGAAAGAAGAGGG - Intronic
955370410 3:58346474-58346496 AAGTAGTACAAGGTAGATGAAGG + Intronic
956198845 3:66684173-66684195 AAGTAGAAGAAGGAGAAGGAGGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956462779 3:69488116-69488138 AAAGAGAAAAAGAAAGAGAAAGG + Intronic
956871223 3:73420247-73420269 AAGGGGAACAAAACAGAGGATGG - Intronic
957025539 3:75177613-75177635 AAATGAAACAAGGAAGAGGATGG - Intergenic
957117534 3:76045816-76045838 AAGAAGAGGAAGAGAGAGGAAGG - Intronic
957221488 3:77388492-77388514 AAGTAGAGAAATAAAGAGGTGGG - Intronic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957531844 3:81450699-81450721 TACTAGGACAAGTAAGAGGAAGG - Intergenic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958754262 3:98231674-98231696 AAATAAAACAGGAAGGAGGAAGG - Intergenic
959000829 3:100962275-100962297 ATGCAGAACAAGAAAGGAGAGGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959341114 3:105133029-105133051 TAGTAGAAAATTAAAGAGGAGGG + Intergenic
959440234 3:106365286-106365308 AAGAAAGACAAGAAAGAGAAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960099245 3:113721636-113721658 AAGAAAAACAAGAACAAGGAGGG + Exonic
960233603 3:115256033-115256055 AAGTAGACCAAGCAGGAGAAAGG + Intergenic
960395653 3:117133539-117133561 GAGTAGATCAAGAAAAAGCAAGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960782799 3:121338661-121338683 AAAGAAAAAAAGAAAGAGGAAGG + Intronic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
961227536 3:125265893-125265915 ATGTAAAACAAGAAAGAGTAGGG + Intronic
961403796 3:126665235-126665257 AAGTCAGACAACAAAGAGGAGGG - Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961817330 3:129557914-129557936 AGGTTGAAGATGAAAGAGGATGG - Intronic
962270274 3:133973065-133973087 AAGTGGAAGATGAGAGAGGATGG + Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
963583736 3:147158573-147158595 AAGGAAGAAAAGAAAGAGGAAGG + Intergenic
963588372 3:147224563-147224585 AATGAGAAAAAGAAAGAGAAGGG + Intergenic
964198646 3:154092655-154092677 AATTAGAACAGGAGAGAGAAAGG + Intergenic
964564315 3:158033109-158033131 AAGAAGAAGAAGAAAAAGAAGGG + Intergenic
964637029 3:158869415-158869437 AAGAAGAAGACGAAAAAGGAGGG - Intergenic
965307787 3:167088673-167088695 GAGTAGAACAACAAAATGGAAGG + Intergenic
965454380 3:168879752-168879774 AAGAAGAGGAAGAAAGAGTAGGG - Intergenic
965498933 3:169433543-169433565 AAGAAAAGAAAGAAAGAGGAAGG + Intronic
965553478 3:169995544-169995566 ATGTAAAACCAGAAAGAGGGGGG - Exonic
965711736 3:171562713-171562735 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
965783851 3:172315983-172316005 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
965882414 3:173401486-173401508 AATAAGAAGAAGGAAGAGGAGGG + Intronic
965939898 3:174167003-174167025 AAGGAAAACAAAAAAGAGTAGGG - Intronic
965951354 3:174311889-174311911 AAGTAGAATTAGAAAGAAAAAGG - Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966630494 3:182069182-182069204 AAGGAAAAAAAGAAAAAGGAAGG - Intergenic
966759766 3:183407547-183407569 AAGAAGCAGAAGAAAGAGGGAGG - Intronic
966997292 3:185295546-185295568 AAGAGGAACAGGAGAGAGGAGGG - Intronic
967644924 3:191911315-191911337 AAAAAAAAAAAGAAAGAGGAAGG - Intergenic
967756256 3:193173155-193173177 AATTAGAAAAAGAGAGAAGATGG + Intergenic
967823782 3:193862448-193862470 AAATAGAATTAGAGAGAGGAAGG - Intergenic
967869027 3:194214424-194214446 AGGTAAACCAAGAAGGAGGAAGG + Intergenic
967931434 3:194693260-194693282 GAGCAGCTCAAGAAAGAGGAAGG - Intergenic
967958010 3:194893043-194893065 AAGTAGAACAAAAAAGCAAAGGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969013925 4:4090420-4090442 AGGCAGAACAAGGAAAAGGATGG + Intergenic
969740056 4:9018019-9018041 AGGCAGAACAAGGAAAAGGATGG - Intergenic
969799219 4:9549528-9549550 AGGCAGAACAAGGAAAAGGATGG - Intergenic
970079898 4:12270527-12270549 AATTAGAACACAGAAGAGGATGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970432848 4:16004926-16004948 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
970802993 4:19997483-19997505 AAGTAGAAAATAAAAGAGAAGGG + Intergenic
970986961 4:22170336-22170358 AAGTAAATCAATAAAAAGGAGGG - Intergenic
971259229 4:25041281-25041303 AAAAAGAAAAAGAAAGAGAAAGG - Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971521299 4:27555133-27555155 AAGAAGAAAAAGAGAAAGGAAGG - Intergenic
971663381 4:29449955-29449977 AGGAAGAAAAGGAAAGAGGAGGG + Intergenic
971752634 4:30670256-30670278 AAGTTGAGCAAGAAAGATCAGGG - Intergenic
971914017 4:32843674-32843696 AAGAAGAGCAAGAAAAAGGATGG + Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
972199038 4:36691024-36691046 ATGGAGAACAAAAAAGAGCAAGG - Intergenic
972454913 4:39244675-39244697 AAGGAGAACAAAAGAGATGAAGG - Intronic
973042549 4:45489385-45489407 AAGTAAAAAAAGAAAGGGAAAGG - Intergenic
973205858 4:47559552-47559574 AAGTTTAGCAAGAAAGAAGATGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973595952 4:52490359-52490381 AAGTAAAGAAAGAAAGAGGAAGG + Intergenic
973999336 4:56495373-56495395 AAGAAGAAAAAGAAAAAGAAGGG + Exonic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974307218 4:60157246-60157268 AAGCAGAAAAAGTAAGAAGATGG - Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974464401 4:62235840-62235862 AAGTAGAGAGGGAAAGAGGAAGG - Intergenic
974606694 4:64160748-64160770 GAATAGAGCAAGAAAGAGAATGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975264972 4:72352839-72352861 AAATAGAACTTCAAAGAGGATGG + Intronic
975342976 4:73261590-73261612 AAGTTGACGAAGAAAGAGTAAGG - Intergenic
975390048 4:73805198-73805220 AAATAAAACAAAAAAGAGCAGGG + Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
976411720 4:84720943-84720965 AGGTTGAGCAAGAAATAGGAAGG + Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
976956001 4:90901109-90901131 ATGAAAAACAAGAAAGAGCAGGG - Intronic
977429368 4:96912210-96912232 AGAAAGAAAAAGAAAGAGGATGG + Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977536064 4:98258467-98258489 TAATAGAACAAGAAAGGAGAGGG + Intergenic
977846375 4:101772807-101772829 AAGAAGAAAAAAAAAGTGGAGGG + Intronic
977879404 4:102187003-102187025 AAGAAAAAAAAGAAAGGGGACGG + Intergenic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
977988090 4:103409156-103409178 AGGCAGAACAGGAAAGAGTAAGG + Intergenic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978108005 4:104928140-104928162 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978317565 4:107456404-107456426 ATGCAGAACAAAAAAGAAGATGG + Intergenic
978588549 4:110299598-110299620 AAACAAAACGAGAAAGAGGAAGG + Intergenic
978657723 4:111085261-111085283 GAGTAGGAAAAGAAAGAGGAAGG - Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978843942 4:113249554-113249576 ACAGAGAACAAGAAAGAGAAAGG - Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979098396 4:116581402-116581424 GAGTAGAAAGAGAAAAAGGAAGG - Intergenic
979140847 4:117172442-117172464 AAGAAGAACAAAGAAGAGAAAGG + Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979548928 4:121968561-121968583 AAGTGGCAAAATAAAGAGGATGG + Intergenic
979561305 4:122105055-122105077 AAATAAACCAAGAAAGAGAAAGG + Intergenic
979876553 4:125898764-125898786 AAGGAGAAAAAGAGAAAGGAAGG - Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
979975611 4:127192591-127192613 AAGTAGCACCAAAAAGAGGAAGG - Intergenic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980411724 4:132428785-132428807 ATGGAAAACAAGAAAGAGCAGGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980749909 4:137075428-137075450 GAAAAGGACAAGAAAGAGGAAGG + Intergenic
980795755 4:137680467-137680489 AAGAAGAAAAAGAAAAGGGAGGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981120047 4:141039367-141039389 AGGTAGAGAAAGAAAGGGGAGGG + Intronic
981293874 4:143107456-143107478 TGGTAGGGCAAGAAAGAGGAAGG - Intergenic
981530435 4:145747818-145747840 AAGAAAAACAAGAAAGAAGGAGG - Intronic
981572873 4:146172055-146172077 AAGAAGGAAAAGAAAGAGGGAGG - Intergenic
981808675 4:148747853-148747875 AAGGGGAACAACAGAGAGGATGG - Intergenic
982334599 4:154220005-154220027 TAGTAGAAAAAAAAAAAGGAAGG - Intergenic
982469764 4:155774035-155774057 AAGGGGTACAAGACAGAGGAGGG - Intronic
982649763 4:158073143-158073165 AAGAAAAGAAAGAAAGAGGAGGG + Intergenic
982844084 4:160227426-160227448 AAGTCGAAAAAGAAAGAAAAAGG + Intergenic
982932136 4:161421738-161421760 GAATAGAACAAAAAGGAGGAGGG + Intronic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983066754 4:163219117-163219139 GTGTAGAACAAGAAAGAGTTTGG - Intergenic
983089099 4:163483283-163483305 AAGTTGAGAAAGAAACAGGAAGG + Intergenic
983182241 4:164662094-164662116 ATGTAGAACAAGAAAGACACTGG + Intergenic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983226384 4:165089732-165089754 AAGAAGGACAAGAAACAGGAGGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984418700 4:179492487-179492509 AGGAAGGAAAAGAAAGAGGAAGG - Intergenic
984615152 4:181888877-181888899 AAATAGAACAAAAATGTGGAGGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
985237685 4:187894096-187894118 AAGAAAAAAAAGAAAAAGGATGG + Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986391053 5:7288684-7288706 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
986670068 5:10134903-10134925 AAGTTAAAAAAAAAAGAGGATGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987284491 5:16441974-16441996 TAAAATAACAAGAAAGAGGAAGG + Intergenic
987354666 5:17052762-17052784 AACCAGAAGAAGAAAGAAGAAGG - Intergenic
987946504 5:24616125-24616147 AAAAAAAAAAAGAAAGAGGAAGG + Intronic
987976587 5:25022480-25022502 AAGTAGAAATAGGGAGAGGAAGG + Intergenic
988079128 5:26393526-26393548 AAGTAGAAAAAGCAAGAAAATGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988275809 5:29079980-29080002 AAGAAGGAAAAGAGAGAGGAGGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988994536 5:36702091-36702113 AAGGAGAAAAAGAGAAAGGAAGG + Intergenic
989103235 5:37839312-37839334 AAGTAGAACCGGAGAGAGGCCGG - Intronic
989352163 5:40498911-40498933 AAGTGGAACAAGAATAAAGAAGG + Intergenic
989455451 5:41638316-41638338 AAAAAGGAAAAGAAAGAGGAAGG - Intergenic
989540636 5:42614342-42614364 AAGTAGAAAAGGAAAAAGGGAGG + Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990171787 5:53059377-53059399 AAGTAGAACAGGTCAGAAGAGGG + Intronic
990247980 5:53882249-53882271 AAGTACAGCAAGAAAGGGAAGGG + Intergenic
990474409 5:56147872-56147894 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
990522245 5:56591496-56591518 AAGGAGACCAAGAAAGAAAAAGG + Intronic
990889911 5:60636677-60636699 TAGTGGAAGAAGAAAGAAGAAGG - Intronic
991203507 5:64021916-64021938 AAGTAGAAAGAGAAAGTGAAGGG - Intergenic
991536829 5:67678498-67678520 GAGTAGAATAAGAAAGAGAATGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992078456 5:73213242-73213264 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
992130560 5:73688229-73688251 AAGTGGAACAATAATCAGGAAGG + Intronic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
992870040 5:80996581-80996603 AAAAAAAAAAAGAAAGAGGAGGG - Intronic
992950061 5:81850023-81850045 ATGGAGAACAATAAAGCGGAAGG + Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994205511 5:97031344-97031366 AAATAAAACAAGATGGAGGAAGG - Exonic
994688410 5:102986163-102986185 AAGTGGAATAAGACAAAGGATGG + Intronic
994798597 5:104339934-104339956 ATTTACAACAAGAAAGAGGAAGG - Intergenic
994913679 5:105945617-105945639 AAAAAGAAGAAGAAAGAAGAGGG + Intergenic
995238016 5:109852307-109852329 AAGAAGAACACTAGAGAGGAAGG - Intronic
995541990 5:113194680-113194702 AAGAAAAAGAAGAAAGGGGAAGG + Intronic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995735886 5:115298542-115298564 AAGAAGAAAAAGAAAGAAGGAGG + Intergenic
996019753 5:118578104-118578126 AAGTACAACATGGAAGAGGGAGG + Intergenic
996028025 5:118672012-118672034 AAGTAGAACAATAATGAGTAAGG - Intergenic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996156585 5:120110298-120110320 GAATAAAACGAGAAAGAGGAGGG + Intergenic
996378347 5:122839169-122839191 AAATATACCAAGAAAGAGGAAGG - Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996497189 5:124172601-124172623 GAGTAGAAAGAGAAAGAGAATGG + Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996606568 5:125329977-125329999 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
996672253 5:126132327-126132349 GAGTAAAACAAGAAAGAGGAGGG + Intergenic
996734784 5:126748644-126748666 AAATAAAAAAAGAAAGAGGGAGG - Intergenic
996946155 5:129070692-129070714 AAAAAGAACAACAAAGAGGCAGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997240694 5:132304621-132304643 AAGAAGAAGAAGAAAGATCAGGG + Intronic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997952780 5:138255080-138255102 AAGAAGAGAAAGAGAGAGGAAGG + Intronic
998514470 5:142740128-142740150 AGATAAAAGAAGAAAGAGGAAGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
998939373 5:147264196-147264218 CAGTAAAACAAGAAAGAAGGGGG + Intronic
999000505 5:147916777-147916799 AAGAAAAAGAAGTAAGAGGATGG + Intergenic
999001511 5:147928823-147928845 AATTAGTACAAGAAGGAGGAAGG - Intergenic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1000414275 5:160967043-160967065 AAGTAGAAAAAGACAGATGGGGG - Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1000823800 5:166018607-166018629 AAGTAAAATAAGTAAGTGGATGG - Intergenic
1000829764 5:166088270-166088292 AAGTTGTACAAGAATGAGGCTGG + Intergenic
1001302446 5:170544573-170544595 AAATAGAAAAACAAATAGGAAGG - Intronic
1001426536 5:171626156-171626178 AAGAAGAAGAAGAAAGGTGAAGG - Intergenic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003530224 6:6930785-6930807 AATTAGAACAAGAAAGCACAGGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1003737778 6:8896863-8896885 AAGGAAGAAAAGAAAGAGGAAGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404982 6:15324481-15324503 AAAAAGAAGAAGAAAAAGGAGGG - Intronic
1004680766 6:17892299-17892321 CATTAGAGCAGGAAAGAGGAAGG - Intronic
1004910856 6:20281630-20281652 AAGTAGAGCAAGCAGAAGGAAGG + Intergenic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006242698 6:32699509-32699531 AAGTAGAGCAGGAAAGAATAGGG + Intergenic
1007052637 6:38847836-38847858 AAGGAGGACAAGAAATAGAATGG - Intronic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007511203 6:42375629-42375651 ACGAAGAACATGAAGGAGGAAGG + Intronic
1007630276 6:43269617-43269639 AAAGAGACCAAGAAAGTGGAGGG - Intronic
1007695125 6:43727108-43727130 AATGTGAACAAGAAAGATGAAGG - Intergenic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008109856 6:47479871-47479893 AATTAGAAAAGGAAAGATGATGG - Intronic
1008156545 6:48022142-48022164 AGATAGAACAAGGAAGAGGGAGG - Intronic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008717825 6:54310401-54310423 AAGAAAAACAAAACAGAGGAAGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009458155 6:63880703-63880725 AAAAAGAAAAAGAAAGAGAAAGG - Intronic
1009536101 6:64888483-64888505 TAATAGAAAAAGAAAGAGTAAGG + Intronic
1009847726 6:69154513-69154535 AGATGGAACAAAAAAGAGGAAGG - Intronic
1009960777 6:70517881-70517903 AAGTAGAGGAAGAGAGATGAAGG - Intronic
1010073284 6:71769673-71769695 AAGTTAACCAAGAAAGGGGAAGG - Intergenic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010270543 6:73911534-73911556 AAATACAACAAAAAAGATGAGGG + Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010499295 6:76576325-76576347 AAGTAGAACATGAAAGACTGAGG + Intergenic
1010715277 6:79221799-79221821 ATGGAAGACAAGAAAGAGGAGGG + Intronic
1010813948 6:80332885-80332907 AAGATGAGCAAGTAAGAGGAAGG - Intronic
1010864369 6:80955506-80955528 AATAAAAACAAGAAATAGGAAGG + Intergenic
1011115758 6:83889848-83889870 AGCAAGAAAAAGAAAGAGGAGGG + Intronic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1011720900 6:90155683-90155705 AAACAGAGCAGGAAAGAGGAGGG - Intronic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012180043 6:96141494-96141516 AATTAAAGCAAGAAAGTGGAGGG + Intronic
1012351078 6:98251200-98251222 AAGTAAACCAACAAAGAGAATGG + Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012555477 6:100506112-100506134 AAATGTAACAAGAAAGAGGAAGG + Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013080599 6:106808640-106808662 AAGGAGAAAAAGAGAGAGCAGGG - Intergenic
1013490869 6:110645540-110645562 AAGTAGAAGTAGAAAGATAAAGG + Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013854350 6:114553519-114553541 AAGTTGAACAACAAAGGGAAGGG - Intergenic
1014687379 6:124518990-124519012 AAGAAGTACAAGAACCAGGATGG + Intronic
1014896174 6:126902744-126902766 AAATAGAATTAGAAAGAGAAAGG + Intergenic
1015065295 6:129019113-129019135 AAGTAAACCAAGAAAGAGGAAGG - Intronic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015145757 6:129984590-129984612 GAGAGGAACAAAAAAGAGGATGG + Intergenic
1015698813 6:136012062-136012084 AAGTAGAACAAGGAAGTTAAAGG - Intronic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1016090626 6:139974468-139974490 TAGTATAACAAGAAAAAGGGAGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017249300 6:152262633-152262655 AGGTAGTACAGGACAGAGGAAGG + Intronic
1017328341 6:153166279-153166301 GAGCAGGACAAGAAAGAGGAAGG + Intergenic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017483524 6:154881653-154881675 AAATAAAAAAAGAAAGAGGCAGG + Intronic
1017650911 6:156581720-156581742 ACGAAGAACAAGAGAAAGGATGG + Intergenic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018950797 6:168377627-168377649 AAGTAGAAGAGGAAATCGGAAGG - Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019693236 7:2429370-2429392 AAGTACAAAAAAAAAGAGGCCGG - Intronic
1019772270 7:2891175-2891197 AAGAAAAAAAAAAAAGAGGAGGG - Intergenic
1019847372 7:3519115-3519137 AAGTAGAACAGAGAATAGGAGGG + Intronic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1021277227 7:18667000-18667022 AACTAAAAAAAGAGAGAGGAAGG - Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021636092 7:22695182-22695204 AAATAAGCCAAGAAAGAGGAAGG - Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022039891 7:26570991-26571013 AACTAGAGCAAGAGAGAGCAAGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047377 7:36222381-36222403 GAGGAGGACAAGGAAGAGGAGGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023228759 7:38001602-38001624 AACTACAACATAAAAGAGGAAGG - Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023601435 7:41885340-41885362 TAGTCAAATAAGAAAGAGGAAGG + Intergenic
1023901112 7:44479850-44479872 AGGTAGAACAAGGAAAAGGATGG + Intronic
1024005459 7:45222262-45222284 AAGAAGCCCAGGAAAGAGGAAGG - Intergenic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024203888 7:47135455-47135477 GAGAAGAAAAGGAAAGAGGAAGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024960825 7:54973344-54973366 AAGTAGAACAACAAAAAAGCAGG + Intergenic
1024999546 7:55303652-55303674 AAAAAGAAGAAGAAAGAAGAAGG + Intergenic
1025040326 7:55637759-55637781 AACTAGATCTAGAAAGTGGAAGG + Intergenic
1025289461 7:57701820-57701842 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026110546 7:67455695-67455717 GAGAAGAGAAAGAAAGAGGAAGG - Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026229216 7:68468921-68468943 AAGAAGAAAAAGAGAGAGGGAGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1026517630 7:71086639-71086661 AAGAAAAAAAAGAAAGAGAAGGG + Intergenic
1026875677 7:73877784-73877806 AAAAAGAAAAAGAAAGAGGTCGG - Intergenic
1027046247 7:74993200-74993222 AAAGAGAAAAAGAAAAAGGAAGG + Intronic
1027355443 7:77349775-77349797 AAGTGAAAGAAGAGAGAGGAAGG - Intronic
1027394155 7:77736481-77736503 AATGAGATCAAGAAAGAGAATGG + Exonic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027646704 7:80810586-80810608 AAGTAGACAACGAAAGAGGGAGG - Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027942450 7:84701553-84701575 ATGTAGACCAAGGAAGAAGACGG + Intergenic
1027969901 7:85066239-85066261 AAGGAGAAAAAGAGAGAGAAAGG + Intronic
1028094412 7:86742541-86742563 AAATAGAAGATGTAAGAGGAAGG + Intronic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028256013 7:88598482-88598504 AAGAAGAACAAGAAAGCGGAGGG + Intergenic
1028725221 7:94078929-94078951 AAGTAGAGAAAGAGAGGGGATGG - Intergenic
1029072580 7:97912034-97912056 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1029181666 7:98706311-98706333 AAGGAGAAAAAGAAAAAGAAGGG - Intergenic
1029534884 7:101151341-101151363 AAGTAAAAGAAGAAAGAAGTTGG + Intergenic
1029575606 7:101401489-101401511 GACTAGAAGAAGGAAGAGGAGGG + Intronic
1029615701 7:101655848-101655870 AAATAAACCAAGAAAGAGGGAGG - Intergenic
1029633834 7:101770593-101770615 AGGAAGAAAAAGAAAGAGAAAGG - Intergenic
1029684322 7:102135391-102135413 AAGTAGGCCAAGGAAGAGGAGGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030191068 7:106810604-106810626 AAGTAGAATAGGACAGGGGAAGG + Intergenic
1030332514 7:108286444-108286466 AAGGCGAACAAGTAAGAGTAGGG + Intronic
1030656223 7:112171439-112171461 AAGTAGAAAAAAAAAGATAAAGG - Intronic
1030842527 7:114373550-114373572 AAGTAGAATAAGAAAGAACTGGG - Intronic
1030962064 7:115936817-115936839 GAGTTGAAAAAGGAAGAGGAAGG + Exonic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031014906 7:116562925-116562947 AGGAAGAGAAAGAAAGAGGAAGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031739898 7:125416857-125416879 AAGTATAATAAAAAAAAGGAAGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1032819246 7:135509743-135509765 AAGAAGACCAAGGAGGAGGAGGG + Intronic
1032989961 7:137382758-137382780 AAGTAGAACAAGAAAGAAGGTGG + Intronic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033277646 7:139984695-139984717 AGAAAGAAAAAGAAAGAGGAAGG + Intronic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033724635 7:144101404-144101426 GAGTAAATCAAAAAAGAGGATGG - Intergenic
1033850571 7:145489338-145489360 AAGAAGAACAAGATTGAGGCAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034864789 7:154631845-154631867 AAGTTCAACAAGAAGCAGGAGGG + Intronic
1035110779 7:156479854-156479876 AACAAGAAAAAGAAAGAGGAGGG + Intergenic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1035947998 8:3986506-3986528 GAGTAGAAAAAGAAAGGAGAAGG - Intronic
1035978413 8:4339703-4339725 GAGAAGAAAATGAAAGAGGACGG + Intronic
1036245086 8:7109268-7109290 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1036255661 8:7204541-7204563 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036361823 8:8082961-8082983 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1036475100 8:9086056-9086078 AATTAGGACTTGAAAGAGGACGG - Intronic
1036889145 8:12584054-12584076 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036896733 8:12642196-12642218 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1037002803 8:13741124-13741146 AATTAGAACAGGAGACAGGAGGG + Intergenic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037244754 8:16820719-16820741 AAGAAGAACAAGACTAAGGATGG + Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037277727 8:17199745-17199767 AAAAAGAAGAAGAAAGAAGAAGG - Intronic
1037699100 8:21256228-21256250 AAGAAGAACAAGAATGAGTGAGG - Intergenic
1037725765 8:21481399-21481421 AAGTAGAGAAGGAAAGAAGAGGG + Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038216549 8:25566981-25567003 AAGCAGAGAAAGAAAGACGAAGG - Intergenic
1038290882 8:26248887-26248909 AAATAGAAAAATAAAGAGGCTGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038820895 8:30951107-30951129 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1039026467 8:33263602-33263624 AAGTGGTACAAGATAGAGGCAGG - Intergenic
1039153877 8:34533657-34533679 AAATATAACAAGACAGAGGCTGG - Intergenic
1039411374 8:37357955-37357977 AAGTAGGAGAAGAAATGGGAAGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040056824 8:43065776-43065798 AAGTAAATCAAGAAAGAGAAAGG - Intronic
1040463482 8:47672343-47672365 CAGTAAAACAAGACAGAGGAGGG - Intronic
1040543787 8:48381412-48381434 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1040894778 8:52354761-52354783 AAGTTGAGCAAGAAAGAGAAGGG + Intronic
1041094973 8:54341227-54341249 ATGTAAAACAAGAGAGAAGATGG + Intergenic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1041459094 8:58092101-58092123 AAGTAAAATATGAAAAAGGAAGG - Intronic
1041860548 8:62508205-62508227 AGGAAGCACAAGGAAGAGGAAGG + Intronic
1042098056 8:65240717-65240739 AAGGAGACCACAAAAGAGGAAGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042430404 8:68699910-68699932 AAATTTAACAGGAAAGAGGATGG + Intronic
1042601718 8:70505586-70505608 AAAAAGAAAAAGAAAGAAGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043332683 8:79137153-79137175 AAATAGAACAAAGAGGAGGAAGG + Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043664739 8:82794402-82794424 AAATAAAAAAAGAAATAGGAAGG + Intergenic
1043699887 8:83272438-83272460 AAGTAAAACAAGACTGAGCATGG - Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044173116 8:89081657-89081679 AAGTAAGGAAAGAAAGAGGAAGG - Intergenic
1044256694 8:90071592-90071614 AAGTAACACAAGAAAGAAGAGGG + Intronic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1044656864 8:94557619-94557641 TAATAGCACAAGAAAGAGAAAGG + Intergenic
1044913567 8:97088037-97088059 AAGAGAAACAAGAAAGAGAATGG + Intronic
1045101799 8:98852008-98852030 AAAAAGAAAAAGAAAGAAGAAGG + Intronic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045849779 8:106681075-106681097 TACTGGAACAAGAAAGAGAAAGG - Intronic
1045897350 8:107235498-107235520 GAGTAGGACAAGAAGGAGAAGGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046286981 8:112106981-112107003 AAGAAGAAAAATGAAGAGGAAGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046506490 8:115144578-115144600 AATTTGAACAGAAAAGAGGAAGG - Intergenic
1046574102 8:116003913-116003935 CAATAAAACAAGAAACAGGAGGG + Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046750577 8:117922610-117922632 AAGGAGAACAAGAGAGAAGCTGG + Intronic
1046817553 8:118601458-118601480 AAATAGAATAATAATGAGGAGGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1046928021 8:119814188-119814210 AAGTAGAAGATGAAATAGTAAGG + Intronic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047588018 8:126295181-126295203 AATTAGAAAAAGAAAGAGACTGG + Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1048518903 8:135136069-135136091 TAGGAGAACAAGAAAGTAGAGGG + Intergenic
1049041893 8:140118759-140118781 GAGTAGAAAAAGACAAAGGAAGG + Intronic
1049581780 8:143415312-143415334 AAGTCAACCAAGAAAGAGAAGGG + Intergenic
1050193510 9:3055484-3055506 AAGTAGAATAAGATAAAGAAGGG + Intergenic
1050361435 9:4835013-4835035 AAGTAGAGCAAGAAAGGAGGAGG + Intronic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050685688 9:8166399-8166421 AACATGAACAAGGAAGAGGAGGG + Intergenic
1050942169 9:11473144-11473166 AAGAAGCAGAAGAAAGAAGAAGG + Intergenic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1050970145 9:11860225-11860247 CAGGAGGACAAGAAAGAGTATGG + Intergenic
1051002566 9:12302960-12302982 AAGTAGGTTAAGAAAGAGAAAGG + Intergenic
1051756762 9:20409186-20409208 AAGTAAGGCAAGAAAGAGGAAGG + Intronic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052393780 9:27912969-27912991 AAGGAGAACAATAAAGCTGAAGG - Intergenic
1052597649 9:30580834-30580856 AAGAGGAACAAGAAAGTGGAGGG + Intergenic
1052606637 9:30712371-30712393 AAGCAAAATAAGAGAGAGGAAGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053147942 9:35724547-35724569 AAGCAGAACTAGAAAAAAGAGGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054826604 9:69579776-69579798 AAGTGGGTCAAGGAAGAGGAAGG + Intronic
1054861888 9:69962419-69962441 AAGAAGAAAAAGAAAAAGAAAGG + Intergenic
1054913049 9:70471615-70471637 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1054973734 9:71118792-71118814 AGGTGGAACAAGAGAGAGAAGGG + Intronic
1055010359 9:71558929-71558951 AAAAAGAAAAAGAAAAAGGAAGG - Intergenic
1055025562 9:71716218-71716240 AAGTAGGGGAAAAAAGAGGAAGG - Intronic
1055064290 9:72103033-72103055 GAGCAAAGCAAGAAAGAGGAAGG - Intergenic
1055166305 9:73199596-73199618 AAGAAGGAAAAGAAAAAGGAAGG + Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055807059 9:80107669-80107691 AAGTAGAGCAAGGAAGAGGAGGG + Intergenic
1056337226 9:85584377-85584399 AAGGAATACATGAAAGAGGAAGG - Intronic
1056643793 9:88392635-88392657 AGGTAGAAAAAGAGGGAGGAAGG - Intronic
1056697627 9:88873345-88873367 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1056876715 9:90340337-90340359 AAGTGAAACAAGAAAAAGAAGGG + Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1058159505 9:101552549-101552571 AAGAAGAACGAGAACGAGAAAGG + Exonic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059352903 9:113678151-113678173 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1059588333 9:115630174-115630196 AGGTGGAGAAAGAAAGAGGAAGG + Intergenic
1059588816 9:115635264-115635286 CAGGAGCACAAGACAGAGGAAGG - Intergenic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1059788454 9:117613004-117613026 AAGTTGAACAAGAAGAAAGAAGG - Intergenic
1059826690 9:118037787-118037809 AAGTAGAACAGGACAGCGTAGGG - Intergenic
1060131720 9:121106619-121106641 AAGTTTGAGAAGAAAGAGGAAGG + Intronic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060199160 9:121641818-121641840 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1060493543 9:124101795-124101817 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1062638474 9:137504074-137504096 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1203611094 Un_KI270749v1:5120-5142 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185534416 X:849484-849506 AAGGAAACAAAGAAAGAGGAAGG - Intergenic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186014588 X:5176624-5176646 AAGTGAAACAAGAATAAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186102595 X:6172922-6172944 AGGAAGAACAAGAAAGCTGATGG + Intronic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186384877 X:9099898-9099920 CAGTAGAACAGAAAAGAGGAAGG + Intronic
1186400662 X:9256388-9256410 AAGTAAAGGAAGAAAGAAGATGG + Intergenic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1186835027 X:13429033-13429055 AAGAAGAAGAAGAAAGAAAAGGG - Intergenic
1186846914 X:13540102-13540124 AAGAAGAAAAAGAAAAAGAAAGG + Intergenic
1187357939 X:18595859-18595881 AAGTAGAGCCAGAAAGAGTCTGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1187696156 X:21923157-21923179 AAGGAGAGAAAGAAAGAGAAAGG + Intergenic
1188303075 X:28529291-28529313 GAGTAGACCACTAAAGAGGAGGG - Intergenic
1188349745 X:29113364-29113386 AAGAAGATCAATAAAGAGGAGGG - Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189596343 X:42570433-42570455 AATTATAACAAGGAAGTGGATGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189860426 X:45265622-45265644 AAGCAGAACAGGAAAAAGAAAGG - Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190059920 X:47204047-47204069 AATGGGAACAAGAAAAAGGAGGG - Intronic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190635235 X:52426532-52426554 AAGCAAAGCAAGACAGAGGAGGG - Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1190827116 X:54027917-54027939 AGGTAGAAAAAAAAACAGGAAGG + Intronic
1190887279 X:54541094-54541116 AAGAAGAAAAAGAGAGATGAAGG - Intronic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191616119 X:63171252-63171274 ATGAAAAACAAGAAAGAGCAGGG + Intergenic
1191620178 X:63207671-63207693 ATGAAAAACAAGAAAGAGCAGGG - Intergenic
1191821800 X:65318383-65318405 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1192033255 X:67537627-67537649 AAGTAGTATAAGAAAGAGAGGGG - Intergenic
1192034605 X:67548211-67548233 TAGTAAAGAAAGAAAGAGGAGGG + Intronic
1192121137 X:68457099-68457121 AAGTAAAAAAAGAAGCAGGATGG + Intergenic
1192176587 X:68890041-68890063 AAATAGAACAAGGAAAGGGAAGG - Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192262059 X:69511358-69511380 AAAGAGAGCAAGAAAAAGGATGG - Intronic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192315196 X:70045796-70045818 GAGTAAACCAAGAAAGAGGAAGG + Intronic
1192436444 X:71146106-71146128 GAGAAGAAAAAGGAAGAGGAGGG - Intronic
1192550719 X:72051573-72051595 AGGTAGGAGAAGCAAGAGGAAGG - Intergenic
1192589582 X:72348840-72348862 AAATAGAAAAAGAAAGAATATGG - Intronic
1192593559 X:72382985-72383007 AAGTAGAATACGAAATAGCAAGG - Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193429070 X:81377946-81377968 AAGTACAACAAGAGAGGGGATGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194184227 X:90752762-90752784 AAGTAGTAGTAGAAAGTGGAGGG + Intergenic
1194193410 X:90864783-90864805 ACGGAGAACAAGAAAAAGCAGGG + Intergenic
1194480404 X:94414968-94414990 AAGAAGAACGAGAAAGAAAAGGG - Intergenic
1194938609 X:99981879-99981901 AACAAGAACAAGAGAGAAGAAGG - Intergenic
1195348901 X:103978544-103978566 AATTATAGGAAGAAAGAGGAAGG + Intergenic
1195358542 X:104060295-104060317 AATTATAGGAAGAAAGAGGAAGG - Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196231182 X:113223943-113223965 AAGTAGAAGAAAATAGAGTACGG + Intergenic
1196351437 X:114735560-114735582 AATTAGGAAGAGAAAGAGGAAGG + Intronic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1197607202 X:128597954-128597976 ACGTAGAAGAAGGAAGAGCAGGG - Intergenic
1197904823 X:131413424-131413446 AAGAAGAAGAAGAAAGAAAAGGG + Intergenic
1198041713 X:132859584-132859606 AAGAAGAAAAGAAAAGAGGAGGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1198818751 X:140622389-140622411 AAAAAGAAGAAGAAAGATGAAGG + Intergenic
1198852541 X:140980497-140980519 AAGAAGAATAATGAAGAGGAAGG - Intergenic
1199350972 X:146799271-146799293 ATGTAGAATAAGAAAGACCAAGG - Intergenic
1199496078 X:148453879-148453901 AAATAGAAAAAGACAGAGAATGG - Intergenic
1199522690 X:148754072-148754094 AAGTAGACCACAAAAGAGGAAGG + Intronic
1199539145 X:148939105-148939127 GAGGAAGACAAGAAAGAGGAAGG + Intronic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200540021 Y:4447170-4447192 ACGGAGAACAAGAAAAAGCAGGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200692078 Y:6316450-6316472 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1200713636 Y:6512489-6512511 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1201020291 Y:9649552-9649574 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1201043194 Y:9858277-9858299 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201317122 Y:12658436-12658458 AGGTAGAACAAGAATGAAGTGGG + Intergenic
1201456165 Y:14168877-14168899 AAGTAAACCCAGAAAGAGCAAGG + Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201741299 Y:17326619-17326641 AAGAAAGACAAAAAAGAGGAAGG + Intergenic
1201852215 Y:18497803-18497825 GCTCAGAACAAGAAAGAGGACGG + Intergenic
1201881106 Y:18822581-18822603 GCTCAGAACAAGAAAGAGGACGG - Intronic