ID: 1112388901

View in Genome Browser
Species Human (GRCh38)
Location 13:98964833-98964855
Sequence TGAGCAGCAGGCCTCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112388896_1112388901 16 Left 1112388896 13:98964794-98964816 CCTTCTGAAAAAGAGACTCCACA 0: 1
1: 0
2: 1
3: 24
4: 268
Right 1112388901 13:98964833-98964855 TGAGCAGCAGGCCTCCCAGATGG 0: 1
1: 0
2: 0
3: 27
4: 243
1112388895_1112388901 17 Left 1112388895 13:98964793-98964815 CCCTTCTGAAAAAGAGACTCCAC 0: 1
1: 0
2: 0
3: 15
4: 179
Right 1112388901 13:98964833-98964855 TGAGCAGCAGGCCTCCCAGATGG 0: 1
1: 0
2: 0
3: 27
4: 243
1112388898_1112388901 -2 Left 1112388898 13:98964812-98964834 CCACACAGCTGCTACCTGAGGTG 0: 1
1: 0
2: 2
3: 32
4: 222
Right 1112388901 13:98964833-98964855 TGAGCAGCAGGCCTCCCAGATGG 0: 1
1: 0
2: 0
3: 27
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112388901 Original CRISPR TGAGCAGCAGGCCTCCCAGA TGG Intronic