ID: 1112392206

View in Genome Browser
Species Human (GRCh38)
Location 13:98995837-98995859
Sequence GGCTGAGTTAGTGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112392201_1112392206 28 Left 1112392201 13:98995786-98995808 CCGGAAGATACTTTTAAACATGG 0: 1
1: 0
2: 4
3: 23
4: 394
Right 1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG 0: 1
1: 0
2: 3
3: 18
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112392206 Original CRISPR GGCTGAGTTAGTGCAAATTG AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
907830925 1:58063475-58063497 GGCTGAGTCTGTGCCAAGTGTGG - Intronic
910375064 1:86559395-86559417 GGCTTAGTTGATGCAAACTGAGG - Intronic
911974648 1:104476588-104476610 GGCTGGATTACTGAAAATTGAGG + Intergenic
912043834 1:105427861-105427883 GGCTGGGTCAGTGAAAATTGAGG + Intergenic
913333853 1:117690180-117690202 GGCTGAGTTCGTGTGTATTGGGG + Intergenic
917240037 1:172938334-172938356 GGCTGAGGGAGTGTAGATTGGGG - Intergenic
918716660 1:187797492-187797514 AACTGAGTCAGTGCAATTTGAGG + Intergenic
919564202 1:199163094-199163116 GGCAAAGTGAGTGCAAAGTGAGG - Intergenic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
924622551 1:245674734-245674756 GGCTGAGTTACTGCAAAGAAAGG + Intronic
1070336542 10:75460478-75460500 GGCTCAGAAAGTGCAAATGGTGG + Intronic
1070506349 10:77116716-77116738 GCCTTAGGCAGTGCAAATTGGGG - Intronic
1076330322 10:129659585-129659607 TGATGAGTTAGTGCAAATTGAGG + Intronic
1077594648 11:3521472-3521494 GGCTGTGTTAGTGCATTGTGGGG + Intergenic
1077859248 11:6160444-6160466 GGATGAGTTTGGGCAAGTTGTGG - Intergenic
1084817716 11:71659449-71659471 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
1084822287 11:71700602-71700624 GGCTGTGTTAGGGCATTTTGGGG - Intergenic
1090681912 11:129068850-129068872 TGATGAGATACTGCAAATTGAGG - Intronic
1092425273 12:8370580-8370602 GGTTGAGTTAGTAGAAACTGAGG + Intergenic
1092929227 12:13299593-13299615 TGCTGAGTCAGTTCAATTTGTGG + Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1096053739 12:48633570-48633592 GGCAGTGATAGTGCCAATTGGGG - Intergenic
1096614612 12:52824729-52824751 GGGTGCCTTTGTGCAAATTGGGG + Intronic
1097039318 12:56145435-56145457 GGCTGAGTTTGTGGACAGTGTGG - Intergenic
1097802092 12:63925833-63925855 GGCTGGGTTAGGGGAAAGTGGGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1110299513 13:73909362-73909384 GGCAGAGTTAGTACAAACTTTGG - Intronic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1116178412 14:41504415-41504437 AACTCAGTTAGTGTAAATTGTGG + Intergenic
1119966052 14:78916824-78916846 GGCTGAGTTGGTGCCTTTTGAGG + Intronic
1125182553 15:36894442-36894464 GTCTGTGTTTGTGCACATTGGGG + Intronic
1125775642 15:42210381-42210403 GTATGAGTTAGTGAAGATTGTGG + Intergenic
1125920622 15:43523438-43523460 GGCTGAGTTAGAAGAAATGGAGG + Exonic
1139348593 16:66321157-66321179 GGCTGTGTTCCTGGAAATTGGGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1143684366 17:8502340-8502362 GGCTGAGCCAGTGGAACTTGGGG - Intronic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1146841097 17:36154814-36154836 GTCTCAGTTTCTGCAAATTGGGG + Intergenic
1148714554 17:49706835-49706857 GGCTGTGTAAGTACAAAATGGGG + Intronic
1148833590 17:50452917-50452939 GGATCAGTTAGTAGAAATTGTGG + Intronic
1153246564 18:3078017-3078039 ACCTGAGTTACTGCATATTGAGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159708003 18:71717424-71717446 GGCTGAGCTTGGGCAACTTGTGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1168600467 19:57713963-57713985 GGCAGAGTAAATGCATATTGGGG + Intronic
929687543 2:44047544-44047566 GGCTAAGTTGGTGGAAATTGGGG - Intergenic
931202947 2:60118080-60118102 AGATAAGTTACTGCAAATTGAGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
933990015 2:87627405-87627427 GGCTGTGTTAGTGCTGATTATGG - Intergenic
936303830 2:111323419-111323441 GGCTGTGTTAGTGCTGATTATGG + Intergenic
943338350 2:186646005-186646027 GGCTGTTTAAGTGCAAAATGCGG + Intronic
1169263429 20:4153671-4153693 GGCAGGGTTAGTGGAAACTGAGG + Intronic
1173706457 20:45113981-45114003 CTCTGAGTTAGTGCCAAATGTGG - Intronic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
949262615 3:2119916-2119938 TGCTGAGATAGTGCATAATGTGG + Intronic
949328500 3:2894652-2894674 AGCTGAGTAAGAGCAGATTGAGG + Intronic
950751322 3:15130601-15130623 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
951901914 3:27665336-27665358 GGCGGAGTCAGTGGAAATTATGG + Intergenic
952061757 3:29519293-29519315 GGCTGTGTCAGTGCAGATTGAGG + Intronic
953203590 3:40800042-40800064 GGATGCGTTAGTGCACATTAAGG + Intergenic
957069982 3:75560086-75560108 GGTTGAGTTAGTGGAAACTGAGG + Intergenic
961284134 3:125786652-125786674 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
969013571 4:4087544-4087566 GGTTGAGTTAGTAGAAAATGAGG + Intergenic
969075510 4:4575018-4575040 GGCTGAATTAGTTCAATTTCAGG - Intergenic
969740239 4:9019576-9019598 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
969799569 4:9552376-9552398 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
970966127 4:21930145-21930167 GGCTGCTTTAGTACATATTGAGG - Intronic
973558838 4:52113591-52113613 GACTGAGTTGGGGCAAAATGTGG + Intergenic
976419673 4:84826826-84826848 GGCTGAGGTACTGCAAATCCAGG + Exonic
976860530 4:89660489-89660511 GCCTGTGTAAGTGCAACTTGAGG + Intergenic
979658013 4:123219537-123219559 TGCTAAGTCAGTGCAAAATGTGG + Intronic
986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG + Intergenic
986209495 5:5657345-5657367 GGTGGGGTTATTGCAAATTGAGG - Intergenic
989415770 5:41173408-41173430 GGCTGAGTTAGTACTATCTGGGG + Intronic
992256044 5:74922399-74922421 GGCTGAGTTAGTAAAAAGTGAGG + Intergenic
993938851 5:94034628-94034650 GGCAAAGTTGGTGCAATTTGAGG - Intronic
996576256 5:124979354-124979376 GGCTGAGTGAGTGGAAAGTGAGG + Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
1001646499 5:173285953-173285975 GGCTGAAGCAGTGCAAAGTGAGG + Intergenic
1001872090 5:175165373-175165395 GGCAGAACTAGTGCAAAATGGGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1005987350 6:30883361-30883383 GGCTGAGGTAGTGCTGAGTGGGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1006751238 6:36379058-36379080 AGCTGACTTAGTGTAAAATGTGG + Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1018337690 6:162812106-162812128 GGCTGTATAAGGGCAAATTGAGG + Intronic
1019549945 7:1597138-1597160 TGATGAGTTATTGCAAACTGTGG + Intergenic
1022597755 7:31728880-31728902 GGCTGAGTAAGTACAAAGAGGGG + Intergenic
1022611870 7:31883828-31883850 GGCTGATTTTCTGCTAATTGTGG - Intronic
1023847004 7:44127953-44127975 AGCTGGGTTAGTCCAAATTCAGG - Intergenic
1024047765 7:45596653-45596675 GGCTGAGTGAGGTCAAGTTGAGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026405790 7:70064200-70064222 TGCTGATTTAGTGCTAACTGGGG + Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029072222 7:97909162-97909184 GGTTGAGTTAGTAGAAACTGAGG + Intergenic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1036245443 8:7112129-7112151 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
1036362166 8:8085834-8085856 GGTTGAGTTAGTAGAAACTGAGG - Intergenic
1036648351 8:10625877-10625899 GGCTGAGTCAGTGCAGGTGGGGG + Intronic
1036896388 8:12639333-12639355 GGCTGGGTTAGTAGAAACTGAGG + Intergenic
1040414986 8:47187908-47187930 GGCTGAGTGAGTGCAGAGTGCGG + Intergenic
1040773944 8:51015937-51015959 GGCTGAGATAGTGCTCAGTGAGG + Intergenic
1048063698 8:130946846-130946868 GGCTCAGTTAAAGCAGATTGTGG - Intronic
1048386168 8:133914448-133914470 TGCTTAGTTAGCGCACATTGTGG + Intergenic
1049083040 8:140457622-140457644 GGCTGTGTAAGTGCAAAGCGGGG - Intronic
1055006964 9:71518600-71518622 GGCTGAATTAATGCAAATATTGG - Intergenic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1058340970 9:103896010-103896032 GGAAGAGTTAGTGAAAATAGGGG - Intergenic
1188627184 X:32299071-32299093 TCCTGTGTTAGTGCAAAATGTGG - Intronic
1189185596 X:39052235-39052257 GGCTGGGTTGCTGCAAATAGAGG + Intergenic
1189753975 X:44252215-44252237 GGCTGCGAAAGTGCAAATAGAGG - Intronic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1193440408 X:81534149-81534171 GACTGAGTTAATGCAAAAAGTGG + Intergenic
1194209525 X:91054572-91054594 GGCTTTGTTAGTGTAAATCGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195453145 X:105038091-105038113 GGCAGAGTTTGTGCAATTAGTGG - Intronic