ID: 1112395755

View in Genome Browser
Species Human (GRCh38)
Location 13:99029303-99029325
Sequence CTGTAGGGCTGGGGGCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112395755 Original CRISPR CTGTAGGGCTGGGGGCAAAT AGG (reversed) Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
901669978 1:10850406-10850428 CTGGAGGTGTGGGGACAAATGGG - Intergenic
903053448 1:20618647-20618669 CTGTAGGGCTGGGGCCCACTGGG - Exonic
903223240 1:21880616-21880638 CCTTAGGGCTGGGAGCAAAGGGG - Intronic
903499198 1:23792352-23792374 CTGTAGGGCAGGGGGCAGAGGGG - Intronic
905311785 1:37054141-37054163 CTGTAGGGTTCTGGGCAAAGTGG + Intergenic
905658258 1:39700452-39700474 CTCTAGGGGTGGGGGCAGAGTGG - Intronic
906158074 1:43625826-43625848 CTGGAGGGCAGGGGGCAAGAGGG - Intergenic
906210842 1:44011426-44011448 GGGCAGGGCTGGGGGGAAATGGG + Intronic
906241441 1:44244774-44244796 CTGTAGGGGAGGGGGCTACTAGG - Intronic
906324973 1:44839824-44839846 CTGCAGGGCTGGGGGTAGGTAGG + Intronic
906895322 1:49764296-49764318 CGGGAGGGCTAGGGGCAACTGGG - Intronic
909476092 1:76082351-76082373 CAGAATGGCTGGAGGCAAATGGG - Intronic
911246168 1:95520287-95520309 CTATAGGTCTAGGGGAAAATTGG + Intergenic
914880219 1:151540934-151540956 CTGGAGGGCGGGGGGCAAGTAGG + Intronic
916742373 1:167657470-167657492 GTTTAGGGCTGGCTGCAAATGGG + Intronic
918122334 1:181550552-181550574 CAGGAGGGGTGGGGGCAGATTGG + Intronic
919510602 1:198459176-198459198 CAGTAGGGCTGAGGACCAATGGG + Intergenic
919744170 1:200998605-200998627 CGTTAGGGCGAGGGGCAAATTGG + Intronic
919763638 1:201113083-201113105 CTGTAGGGATGGGAGGAGATGGG - Intergenic
921127193 1:212188281-212188303 CTTCAGGGCTGAGGGCAAAAGGG + Intergenic
921127767 1:212193202-212193224 CTGGGGGGTTGGGGGAAAATGGG - Intergenic
921395401 1:214663728-214663750 CTTTGGGGCTGGGGACAAGTCGG - Exonic
922112438 1:222574106-222574128 CTGGAGGGGTGGGGAGAAATGGG + Intronic
922643118 1:227256315-227256337 CTGTTGGGGTGGGGGCCAAGAGG + Intronic
924567802 1:245212537-245212559 CCGTAGGATTGGGGGCAAAGAGG - Intronic
1065239834 10:23694574-23694596 CTGCAGGGCTGGGGACGGATGGG - Intergenic
1065857086 10:29839454-29839476 CAGCAGGGCTGGGGGCTCATGGG + Intergenic
1066256785 10:33687374-33687396 CGATAGGGCTGGTGACAAATGGG + Intergenic
1068726775 10:60311937-60311959 CTACAGGGCTGGAGGCAAGTAGG - Intronic
1069821718 10:71232557-71232579 CTGGAAGGCTTGGAGCAAATGGG + Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072633734 10:97164358-97164380 CTGGAGGCCTGGGGGCAGAGGGG + Intronic
1073697653 10:105889064-105889086 CTGAAGCTCTGGGGGCAAATTGG - Intergenic
1074758568 10:116646822-116646844 CAGTTCTGCTGGGGGCAAATGGG - Intergenic
1076017818 10:127042509-127042531 AGGTAGTGCTGGGGGCAAAGTGG + Intronic
1076048003 10:127310266-127310288 CTGTAGGGGTGGGGGTAAGGGGG - Intronic
1079250488 11:18783474-18783496 CTGTAGGGCTGTGGGAACACAGG - Intronic
1079453578 11:20618408-20618430 CTTTAGTGCTAGGGGCACATGGG - Intronic
1080271046 11:30451100-30451122 CTGTAGGGGTCTGGGCAAATCGG + Intronic
1085669564 11:78449961-78449983 CTGTTGGTCTTGGGGCAGATGGG + Intronic
1087901993 11:103651349-103651371 CTGTTGGGGTGGGGGCACAATGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091228303 11:133971464-133971486 CTGCAGGCCTGTGGGCAGATGGG - Intergenic
1091637064 12:2205187-2205209 CTGAAGGGCTGGGTGAAACTAGG + Intronic
1093599391 12:21002948-21002970 CGGCAGGGGTGGGGGCAAGTTGG - Intergenic
1094189004 12:27677701-27677723 TTGTAAGGCAGGGGACAAATGGG + Intronic
1095643032 12:44506741-44506763 TTGTAGGGCTCTGGGCATATTGG - Intergenic
1095811274 12:46374679-46374701 CTGTACAGCTGAGGGCAAAGTGG + Intergenic
1097099287 12:56575462-56575484 GGGTAGGGCTGGAGGCAGATGGG + Intronic
1112395755 13:99029303-99029325 CTGTAGGGCTGGGGGCAAATAGG - Intronic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1119608042 14:76037821-76037843 CTGTAGGGCTTGGAACACATAGG + Intronic
1120898033 14:89551756-89551778 CGGTAGGGGTGGGGGCAACCAGG - Intronic
1121553269 14:94818491-94818513 CTGCAGGGATGGGGACAGATTGG + Intergenic
1121675775 14:95751545-95751567 CTGTAACGCTGGGAGCAATTGGG + Intergenic
1122198968 14:100110520-100110542 CTGCAGGGCTGGGGGTGAATGGG + Intronic
1122280630 14:100620295-100620317 CTGAAGGGTTAGGGGCAAGTGGG - Intergenic
1126310667 15:47313025-47313047 GTGTGGGGCTGGGGGTACATGGG - Intronic
1126426755 15:48536024-48536046 GTGAGGGGCTGTGGGCAAATGGG - Intronic
1126757147 15:51935947-51935969 CTGTGGGGCTGAGGGAACATAGG + Intronic
1129932133 15:79420469-79420491 CTGTAGGCTTGGGGGAAACTTGG + Intronic
1130232705 15:82109032-82109054 CTTTAGGGCTGGGGCCTACTCGG - Intergenic
1131293921 15:91130710-91130732 CTGCAGTCCTGGGGGCAAAGAGG + Intronic
1131308312 15:91265327-91265349 CTGCAGGGCTGGGGGAACACAGG + Intronic
1134848546 16:17461426-17461448 CTGGAGGGCAGGAGGCACATTGG + Intronic
1136084708 16:27876687-27876709 CTGGAGGCCTGGGGGCCAAGGGG - Intronic
1136481768 16:30546452-30546474 CTGTCGGGGAGGGGGAAAATTGG + Intronic
1136713699 16:32260195-32260217 CTGTAAGGGTGGGGCCAGATGGG + Intergenic
1137235662 16:46615335-46615357 ATGTAGGGGTGGGGGGAGATAGG + Intronic
1138659996 16:58511254-58511276 CTGTCGGGCTGGGGGCATGCAGG - Intronic
1139762931 16:69202077-69202099 CTGAAAGGCTGGGGACAAAAAGG - Intronic
1142000277 16:87660385-87660407 CTGTAGGGCTGGAGTGAAAGGGG + Intronic
1203056359 16_KI270728v1_random:929567-929589 CTGTAAGGGTGGGGCCAGATGGG - Intergenic
1142768683 17:2081175-2081197 CTCTAGGGCTCGGGGCAGACAGG - Intronic
1147321953 17:39651951-39651973 CTGTAGGCCTGGGGGCTACATGG + Intronic
1147374467 17:40015676-40015698 CTGCAGGGCTGGGGACAGAGCGG - Exonic
1149013698 17:51884284-51884306 ATGTAGGGCTGCGAGCAAAGTGG - Intronic
1150603893 17:66675204-66675226 ATGTGGGGCTGTCGGCAAATGGG - Intronic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151390674 17:73784818-73784840 GTGTAGGGCTGTGGGCATGTGGG + Intergenic
1151549310 17:74812821-74812843 CTCCAGGGCTGGGGGCTGATGGG - Intronic
1152111112 17:78358295-78358317 CTGTAGCTCTGGGGGGAAAGAGG - Exonic
1152578054 17:81151553-81151575 CTGGGAGGCTGGGGGCAGATGGG - Intronic
1153880695 18:9419437-9419459 CAGTAAGGCTGGCAGCAAATTGG - Intergenic
1155037013 18:22033305-22033327 CATAAGGGCTGGGGGCCAATGGG - Intergenic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1156293192 18:35767315-35767337 CTGGAGGGTTGGGGGAAAATAGG - Intergenic
1156516688 18:37686146-37686168 TGGTGGGGGTGGGGGCAAATGGG + Intergenic
1157177671 18:45466103-45466125 CTGCAGGGCTCGTTGCAAATTGG - Intronic
1160904979 19:1447736-1447758 CTGGAGGGCTGAGGGTACATGGG - Intronic
1161183569 19:2901208-2901230 CTGGAGGACTGGGGGCAGTTTGG + Intronic
1161575257 19:5051378-5051400 CTGATGGGTTGGGGGCAAAAGGG - Intronic
1162915822 19:13873886-13873908 CTGTAGGCCTGGGGGCACCCGGG + Intronic
1165902058 19:39173671-39173693 CTCCAGGGCTGGGGGCACCTCGG - Exonic
1167426168 19:49430823-49430845 CAATAGGGCTGAGGTCAAATGGG + Intronic
925921228 2:8639251-8639273 CTGAGGGGCTGGGGACAGATGGG + Intergenic
929463711 2:42126027-42126049 CTGTAGGGTGGGGTGGAAATTGG - Intergenic
929782472 2:44965972-44965994 CTTTAGGGCTGGGGACAAAAGGG - Intergenic
938650163 2:133374658-133374680 GTGTAGGGCAGGGGGCATGTGGG + Intronic
940123231 2:150292316-150292338 GAGTAGGGGTGGGGGCAAAAAGG - Intergenic
940341656 2:152587965-152587987 AAGTAGGGCTGGAGGCAGATGGG + Intronic
943532704 2:189104714-189104736 CTGTGGGGGTGGGGGTAAAGTGG - Intronic
944354704 2:198773369-198773391 GTGAAGGGCTGGGGGAAAATCGG + Intergenic
944886976 2:204072863-204072885 CTGAAGGGTTAGGGGCCAATCGG + Intergenic
945194270 2:207223787-207223809 CAGTAGGGATGGGGGCTAAGTGG - Intergenic
946498960 2:220225364-220225386 CTGTATGCCTTTGGGCAAATTGG - Intergenic
947350674 2:229241420-229241442 CTGTTGGACTGAGGGCAAAATGG - Intronic
1169489468 20:6058865-6058887 CTGGAGTTCTGGGGGTAAATGGG - Intergenic
1170290141 20:14760197-14760219 CTGTCGGGCTGGGGGCAGGGTGG + Intronic
1170382840 20:15780660-15780682 CTATAGGGCAAGGGGCAAAATGG + Intronic
1172323421 20:34015801-34015823 CTGTAGGGATGGGGAAAAGTAGG - Intronic
1172347702 20:34217097-34217119 CTCTAGGGATAAGGGCAAATTGG - Intronic
1172520279 20:35561474-35561496 CTGCAGGGCTGGGGGCAAAGTGG - Intergenic
1173183926 20:40824913-40824935 CTGCAGGGCAGGGAGCAACTAGG + Intergenic
1175691296 20:61067711-61067733 CAGTAGAACTGGGGGCAACTGGG - Intergenic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1178633269 21:34280855-34280877 CTGGAAGGCTGCGGGCAAGTGGG - Intergenic
1181309287 22:21935346-21935368 CTGTAGGGGTGGGGGTATAAGGG + Intronic
1182091959 22:27602109-27602131 CTTCAGGGCTGGGGGTAAAATGG - Intergenic
1183093916 22:35541119-35541141 CTCTCGGGCTGGGGGCAGAGAGG - Exonic
1184533566 22:45071658-45071680 CTGGTGGGCTGGGGGCAGTTGGG + Intergenic
950633896 3:14302012-14302034 CAATAGGGGTGGGGGCAACTCGG - Intergenic
950663977 3:14483590-14483612 GGGTAGGGCTGGGAGCAAACTGG + Intronic
951024824 3:17817764-17817786 CTGCAGGGCGGGGGGCATCTGGG + Intronic
951727349 3:25774802-25774824 GTGTAGGGGAGGTGGCAAATGGG - Intronic
952525083 3:34201494-34201516 CTGGAGGGCTGGCTGCAATTTGG + Intergenic
952888644 3:38026947-38026969 TTGCAGGGGTGGGGGCAAAAGGG + Intronic
953391183 3:42534765-42534787 CAGGAGGGCTGGGGGCAGAAGGG + Intronic
953884640 3:46708385-46708407 CTCTAGGGCTGGGGCCAAGGTGG + Intronic
954462439 3:50635008-50635030 CTGTAGGGCTTGGGCTATATAGG - Intronic
954920573 3:54187482-54187504 CTGCAGGGCTGGAGGGTAATGGG + Intronic
957569928 3:81933621-81933643 ATGGAGTGCTGGGGGCAGATGGG - Intergenic
958917331 3:100064329-100064351 CTGGGGAGCTGGTGGCAAATTGG - Intronic
959256976 3:104027861-104027883 CTGAAGGGCATGGGGAAAATTGG - Intergenic
961606033 3:128096182-128096204 CTGCAGTGCTGGGGGCACAAAGG - Intronic
961651192 3:128417452-128417474 CTGCGGGGCTGGGGGCAATGGGG - Intergenic
963506936 3:146198160-146198182 CTGAAGGGCTAGGGACAAAGAGG + Intronic
965682903 3:171270217-171270239 CTTAAGGGCTGGGGGCAACTGGG + Intronic
966470542 3:180283913-180283935 CTGTAGAACTGGGGGCACCTTGG - Intergenic
967695047 3:192521135-192521157 TGGTAAGGCTGTGGGCAAATAGG - Intronic
968289184 3:197525694-197525716 CTGAATAACTGGGGGCAAATTGG - Intronic
968978926 4:3836364-3836386 CTGGAGGGCTGGGGGCACCCAGG - Intergenic
969301993 4:6302520-6302542 CTGTCGGGCTGGGGCCACACTGG - Exonic
970024141 4:11603936-11603958 CTGCAGGGGTGTGGGCAAACTGG - Intergenic
971347189 4:25822219-25822241 GTGAAGGGCTTGGGGCAATTTGG - Intronic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
981203521 4:142012462-142012484 CTCTAGTGTTGGGTGCAAATTGG + Intergenic
982133583 4:152251520-152251542 GTGTAGGGCAGTGGGCATATGGG - Intergenic
982920523 4:161267978-161268000 CTCTAGGGCAGGGGCAAAATAGG + Intergenic
985282402 4:188300442-188300464 GAGGAGGGATGGGGGCAAATTGG - Intergenic
985549719 5:526846-526868 CTGGAGGGCTCGGGGCAGACGGG + Intergenic
985558169 5:568318-568340 CTTCAGGGCTGGGTGCAGATAGG - Intergenic
985702604 5:1382552-1382574 CTGGAGGGGTGGGGGCACATTGG + Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
988440753 5:31229508-31229530 CTGTATGGCTGGTGCCAATTTGG + Intronic
989487307 5:42006690-42006712 AAGTATTGCTGGGGGCAAATTGG + Intergenic
991416251 5:66396035-66396057 CTTTAGGGAAGGGGGCTAATTGG - Intergenic
996865162 5:128112428-128112450 ATGTAGGACTGGTGGCAACTAGG + Intronic
997747116 5:136309048-136309070 CTGTAGAGCTAGGGGCAATGTGG + Intronic
999301022 5:150490439-150490461 CAGTAGGGCTTAGGGCAAAAGGG + Intronic
999523451 5:152376934-152376956 CTGTATGGATGGGGACAAAATGG + Intergenic
999585549 5:153085827-153085849 CTGAAGGGCTGGGGTGATATGGG + Intergenic
1004525162 6:16400519-16400541 CAGTTGGGTTGAGGGCAAATAGG - Intronic
1004982255 6:21038405-21038427 CAGCAGGGCTGGGGGCAGAAGGG + Intronic
1006055203 6:31378898-31378920 CTGCAGGGCTGGGGGTAACCGGG - Intergenic
1008569989 6:52807065-52807087 CTGTAGGGCCTGGGGCAGACAGG - Intergenic
1010215094 6:73394553-73394575 CAGTAGGGGAGGGAGCAAATTGG + Intronic
1012906083 6:105067866-105067888 CTGGAGGCATGGGGGCAAAGGGG - Intronic
1014650065 6:124025354-124025376 CTCTAGAGCTGGGGGTATATTGG - Intronic
1016996047 6:149963084-149963106 CTGAGTGGCTGGGGGCAAAGTGG + Intergenic
1018811216 6:167299793-167299815 CCGCAGGGCTGGGGGCAAGGTGG + Intronic
1019608096 7:1920157-1920179 CTGCAGGGTTGGGGGCAAGCCGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1029736288 7:102467659-102467681 CGGCAGGGCTGGGGGCACCTGGG + Intronic
1031207353 7:118777484-118777506 CTGGAGAGCTGGGAGCAAAAAGG - Intergenic
1033284479 7:140028496-140028518 CTGTAAGGCTGGGGCTAATTGGG - Intronic
1034907213 7:154960418-154960440 CTGTAGGGTAGGGAGCAATTTGG + Intronic
1037664359 8:20955384-20955406 CTGCAGGGCAGGAGGCGAATGGG + Intergenic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1040871392 8:52103090-52103112 CTGTAGGGCTGGAAGCATTTTGG + Intergenic
1043294047 8:78642400-78642422 CTGAGGGGCAGGGGGGAAATAGG - Intergenic
1044203966 8:89470003-89470025 CTGCTGGTCTGGGGGCCAATTGG - Intergenic
1045353837 8:101367442-101367464 ATGTATGGCTGGTGGTAAATTGG - Intergenic
1047826222 8:128579290-128579312 CTGGAGGGCTGGGTGCAGTTGGG - Intergenic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049476431 8:142799177-142799199 CTGAGGGTCTGGGGGCAAACGGG - Intergenic
1049797794 8:144504513-144504535 CAGTGGGGCTGGGGCCAACTCGG - Intronic
1049818192 8:144618256-144618278 GTGTGGGGCTGGGGCCACATGGG + Intergenic
1053114450 9:35489521-35489543 CTGAAGGGCAGGGGGCGCATGGG + Intergenic
1060532285 9:124354964-124354986 CTGGAGGGCTGCGGGCAGACAGG + Intronic
1060545615 9:124457457-124457479 CTCCAGGCCTGGGGGTAAATGGG - Exonic
1061804173 9:133128891-133128913 CCGTGGGGCTGGGGGCAGCTGGG + Intronic
1062087003 9:134654140-134654162 GTGTAGGGCTGGGGGTATGTAGG + Intronic
1062561203 9:137142837-137142859 CTCTAGGGCTGAGGGCACCTTGG + Intronic
1185941411 X:4324093-4324115 CTGCAGGGCTGAATGCAAATAGG - Intergenic
1188467448 X:30498070-30498092 CTATAGCGCTGAGGTCAAATGGG - Intergenic
1189564472 X:42227117-42227139 CTGTATCGCTGAGGGCAAAGAGG - Intergenic
1189658939 X:43277729-43277751 CTGGGGGGCTGGGGACAAAGAGG + Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1199866522 X:151854790-151854812 CTGGAGGGCTCAGGGGAAATGGG - Intergenic
1200137589 X:153882592-153882614 CTGGAGGGCAGGGGGCAGAGGGG + Intronic