ID: 1112397958

View in Genome Browser
Species Human (GRCh38)
Location 13:99050769-99050791
Sequence CAGCTGCTCTAGGGGATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112397958 Original CRISPR CAGCTGCTCTAGGGGATAGA TGG (reversed) Intronic
901888888 1:12244713-12244735 CAGCTGATCTAGGGTGTAGATGG + Intronic
901989090 1:13097879-13097901 CAGCTCCTCCAGGGCAGAGATGG + Intergenic
901992723 1:13128888-13128910 CAGCTCCTCCAGGGCAGAGATGG - Intergenic
905531899 1:38686551-38686573 GAGGTGCACTTGGGGATAGACGG + Intergenic
906675431 1:47690119-47690141 CGGCGGCTCTAGGGGATGTAAGG - Intergenic
907947298 1:59147246-59147268 CTGCTACTCTGGGGGAAAGAAGG - Intergenic
909255402 1:73414384-73414406 CAGCTGCTCTAAGAGATTAATGG - Intergenic
909540996 1:76791319-76791341 CAGGGGCTGCAGGGGATAGACGG - Intergenic
913124179 1:115770031-115770053 CAGCTTCTGCAGGGGCTAGAAGG + Intergenic
913452789 1:119003492-119003514 CAGTTGCTGCAGGGGAGAGAAGG - Intergenic
915142458 1:153775983-153776005 CAGTTGCTCCAGGTGACAGAGGG - Exonic
917044779 1:170847231-170847253 CTGGTTCTCTAGGGGAGAGAAGG - Intergenic
917662420 1:177190351-177190373 GGACTGCTCTAGGGGACAGATGG - Intronic
917707008 1:177645076-177645098 CTACTCCTCTGGGGGATAGAAGG + Intergenic
920074630 1:203327329-203327351 CAGCTGCTCGTGGGGATTGAGGG - Intergenic
920192367 1:204201806-204201828 CAGCAGCTGTAGGGGAGGGAGGG + Exonic
920227145 1:204447119-204447141 CAGCTGCCCCAGTGGACAGAAGG + Intronic
920821158 1:209382679-209382701 TACCTGCTCTAGAGGCTAGAAGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
922956143 1:229602357-229602379 CAGCTGCTCTGTGTTATAGAAGG + Exonic
923045682 1:230354072-230354094 CTGCTGCTCCAGGGAATGGAGGG + Intronic
923277045 1:232405539-232405561 GAGCTGCTCTAGGGGCTGGGTGG + Intronic
1063810556 10:9700452-9700474 CATCTGTTCTAGGTGATAGCTGG - Intergenic
1064675660 10:17757483-17757505 CAGCTGCTCTGGGAGCTAAAGGG + Intronic
1065733926 10:28734233-28734255 CAGCAGCTCTAGGGGTGAGGTGG - Intergenic
1066708751 10:38209542-38209564 CAGCTGCACGAGGGCAGAGAAGG + Intergenic
1069101876 10:64332201-64332223 TAGATGCTATAGGGGAGAGAAGG + Intergenic
1070404802 10:76085432-76085454 CAGCTGCTCCAGGGGACTGCTGG - Intronic
1075979242 10:126722667-126722689 CAGCTGCACTAGGGGGTGGTGGG + Intergenic
1076154998 10:128197290-128197312 AAGCTGCTCAAGGAGATGGAAGG + Intergenic
1077148193 11:1055264-1055286 ACGCTGCTCCAGGGGAAAGAAGG + Intergenic
1077423400 11:2463350-2463372 CCGCCGATCTGGGGGATAGAGGG - Intronic
1077804998 11:5581409-5581431 CAGGTGCTCAAGGAGAAAGATGG - Exonic
1077931726 11:6739879-6739901 CACCTGCTCTGGGGCATACAAGG - Intergenic
1080055748 11:27904625-27904647 AAGCTGCTCTGGGGGATACTGGG + Intergenic
1083213934 11:61206788-61206810 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083216818 11:61225617-61225639 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083219700 11:61244443-61244465 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083500242 11:63099308-63099330 CAGCTGCTCAGGGGGTGAGATGG - Intronic
1084951144 11:72666191-72666213 CACCTGCTCTAGGGGCTGGAGGG + Intronic
1088612264 11:111589263-111589285 CACCAGCCCTAGGGGATGGAGGG + Intergenic
1088783708 11:113161870-113161892 CAGCTGCTCCCTGGCATAGAAGG - Intronic
1089553157 11:119297454-119297476 GTGCTGCTCTCGGTGATAGATGG - Exonic
1089695749 11:120215387-120215409 CAGTTGCTCTAGGGGAGGGGAGG + Intronic
1093960881 12:25271574-25271596 CAGCTCCATTATGGGATAGATGG - Intergenic
1097095763 12:56546866-56546888 CAGCTGCTTTGGAGGATAGTTGG - Intronic
1098022558 12:66170810-66170832 CAGCTGGTGTAGGGGACAGGTGG + Intergenic
1099077256 12:78125418-78125440 CAGCTGCTCTAGGTCATTGGTGG + Intronic
1105766417 13:23564516-23564538 CAGGGGCTCTAGGGGAAGGAGGG + Intergenic
1106240707 13:27910638-27910660 CAGCTGCACTATAGGAAAGATGG + Intergenic
1107725013 13:43290590-43290612 GGGCTGCTATAGGGGAGAGAGGG + Intronic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1113380485 13:109800098-109800120 CAGCTGCACAACTGGATAGATGG - Intergenic
1115800034 14:36982699-36982721 CAGCTACTCTGGGGGTGAGATGG + Intronic
1119126350 14:72130780-72130802 AACCTGCTCTAGGGGAAAGTGGG - Intronic
1120932702 14:89865259-89865281 CAGCTGCTTTAGGTGATAAAAGG - Intronic
1121631137 14:95422719-95422741 CAGCTGCTCTCTGGCATGGAGGG + Intronic
1121677393 14:95765105-95765127 CAGCTGGTTTGGGGGGTAGATGG - Intergenic
1121789795 14:96690433-96690455 CAGCTCCTCTGGGGCAGAGAGGG - Intergenic
1122552260 14:102556416-102556438 CAGCTGCTCTAGGGTGCAGTGGG + Intergenic
1125385528 15:39132449-39132471 CTGCTGCTATAGGGGCTAGTGGG - Intergenic
1125831269 15:42718591-42718613 CAGGTCCTCTAGGGGAAGGAGGG + Intronic
1126088909 15:45034630-45034652 GAGCAGCTGAAGGGGATAGAAGG + Intronic
1126569202 15:50131505-50131527 CAGCTCCTCTAGCGAATAAAAGG - Intronic
1129862698 15:78874747-78874769 CAGCTTCTCAAGGTGAGAGAGGG - Intronic
1131102745 15:89706062-89706084 CAGCTCCTCTTGGGTATATAAGG - Intronic
1135009501 16:18862177-18862199 CAGATGCTCTAGGGATTATAAGG - Intronic
1135316539 16:21451103-21451125 CAGATGCTCTAGGGATTATAAGG - Intergenic
1135369461 16:21883348-21883370 CAGATGCTCTAGGGATTATAAGG - Intergenic
1135409957 16:22226013-22226035 TAGCTGCTGTAAGGGATGGAGGG + Intronic
1135442352 16:22487779-22487801 CAGATGCTCTAGGGATTATAAGG + Intronic
1136313209 16:29429808-29429830 CAGATGCTCTAGGGATTATAAGG - Intergenic
1136326652 16:29531581-29531603 CAGATGCTCTAGGGATTATAAGG - Intergenic
1136441342 16:30271566-30271588 CAGATGCTCTAGGGATTATAAGG - Intergenic
1137518291 16:49169638-49169660 GAGCTCCTGGAGGGGATAGATGG + Intergenic
1139887839 16:70223879-70223901 CAGATGCTCTAGGGATTATAAGG - Intergenic
1140207461 16:72945496-72945518 CAGCTGCTCCAGGAGAAGGAGGG + Intronic
1143633069 17:8149791-8149813 CAGCTCCTCCAGGGTATAGGTGG + Exonic
1145262150 17:21360880-21360902 CAGCTGCTGGAGTGGATGGAAGG + Intergenic
1146768388 17:35545331-35545353 TAGTTGCTCTAGGGGAAATAAGG + Intergenic
1148798109 17:50207111-50207133 GAGCTGCTCCAGGGGAGAAAGGG + Intergenic
1151062759 17:71115051-71115073 CACCTGCTCAAGGGGATAGTGGG - Intergenic
1152324169 17:79625981-79626003 CAGTTGCTCCAGGGGAAAGGCGG + Intergenic
1152800211 17:82327329-82327351 CAGCTGCTGAAGGGGACAGCGGG + Intronic
1152826073 17:82465677-82465699 CAGCTGCTCTGGAGGCTACAGGG - Intronic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157954179 18:52077693-52077715 CAGTACCTCTAGGGGAAAGATGG - Intergenic
1158242933 18:55398049-55398071 AAGCTGCTGGTGGGGATAGAAGG + Intronic
1160516255 18:79480697-79480719 CAGCGGCTCTCGGGCATAGCCGG + Intronic
1161491798 19:4566477-4566499 CAGATGGTCTTGGGGATAGGGGG - Intergenic
1162153872 19:8663824-8663846 CACCTGCTCTGGGGGATGTAGGG + Intergenic
1162256929 19:9498346-9498368 CGGCTCCTCTAGGGGACCGAAGG + Intronic
1163172032 19:15538025-15538047 CAGCTGCTCTAGGAGCAAGATGG + Intronic
925039417 2:719680-719702 GAGCTGCTCCAGGTGAGAGAGGG - Intergenic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
928119075 2:28568923-28568945 CAGCTTCCCTAGGAGGTAGAAGG - Intronic
928699955 2:33888603-33888625 CAGCAAGACTAGGGGATAGAGGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932008023 2:67947201-67947223 AAGCTGCACTTGTGGATAGATGG - Intergenic
932445929 2:71781521-71781543 CAGCTGCACTGGTGGAGAGAGGG + Intergenic
932571490 2:72940725-72940747 CAGCAGCTTTAGGGGACTGAGGG + Intergenic
933121342 2:78541991-78542013 CAGCTGCTCTCGGGGTTGGAGGG - Intergenic
934102738 2:88668455-88668477 ATGCTGCTGTAGGGGAGAGAAGG - Intergenic
935013309 2:99155776-99155798 CGCCTTCTCTAGGGGAGAGAGGG + Intronic
938245274 2:129771884-129771906 CTGCTGCTTTAGGGGAGAGTGGG - Intergenic
941352039 2:164449117-164449139 AAGCTGGTCTAGGGGAGATAAGG - Intergenic
943040154 2:182794932-182794954 CAGCAGCTCTAGAGTATGGAAGG + Intergenic
943267680 2:185756097-185756119 CAGCTCCTCTTGGGCATAAAAGG + Intronic
946255764 2:218440786-218440808 TAGCTGCTCCAGGGGGAAGATGG - Exonic
948416134 2:237805849-237805871 CAGCTACTCAAGGGGGTAGGTGG + Intronic
1169252883 20:4073599-4073621 GAGCTGTTCTTGGGGATGGAGGG + Intronic
1172637026 20:36416853-36416875 CAGCTGCCCGATGGGAGAGAAGG - Intronic
1173644642 20:44625855-44625877 CAGCTGCTTTAAGAGCTAGAGGG - Intronic
1178128144 21:29538434-29538456 TTGCTGCTCAAGGGGATATAAGG + Intronic
1178875365 21:36410074-36410096 CAGCTACTCTGGAGGATAGGAGG - Intronic
1179642349 21:42756051-42756073 CAGCTGCTCTCGGGGCTGGCAGG + Intronic
950272331 3:11627928-11627950 CTGCTGCTCTAGTGCATAGGAGG + Intronic
950412190 3:12846239-12846261 CAGCTGCTCCAGTGGCTAAAAGG + Intronic
950556287 3:13697889-13697911 CAGGTGCTCTGGGGGAAAGGTGG + Intergenic
950621900 3:14212702-14212724 GAGCTGCTCTTGGGTATAGTGGG + Intergenic
952279383 3:31908509-31908531 CAGCTGATCTAGAGGCAAGATGG + Intronic
953457638 3:43055513-43055535 CGGCTGCTGGAGGGCATAGATGG + Exonic
953557952 3:43961770-43961792 CAGCTGCCCTAGGCCAGAGACGG + Intergenic
954107248 3:48415977-48415999 CATCTGCTCCAGGGGAAAGATGG - Intronic
960942932 3:122946344-122946366 CAGCTCCTCTAGGGTATTTAGGG + Intronic
961013158 3:123448990-123449012 CAGCTGCTCTCGGGGCTCGGCGG + Exonic
961558740 3:127714405-127714427 CAGCTCCTTTAGGGGAGCGAGGG - Intronic
961862896 3:129931739-129931761 CAGCTGCTGGAGGGGAAAGAAGG - Intergenic
962471624 3:135714117-135714139 CAGCAGCTCCAGGAGATGGATGG + Intergenic
964843043 3:161015208-161015230 CAGCTGGTTTAGGGGAAGGAAGG - Intronic
965921953 3:173927828-173927850 CAGCTGCTCTCGGGTTCAGAAGG - Intronic
969797842 4:9540027-9540049 CTGCTGGTCTAGGAGATGGATGG + Intergenic
970835600 4:20402018-20402040 CCTTTGCTCTAGGGGAAAGAGGG + Intronic
970960945 4:21870620-21870642 AAGCTGCTCAAAGGGAGAGATGG - Intronic
971761133 4:30766521-30766543 CAACTGCATTAGGGGGTAGAAGG + Intronic
978717531 4:111864107-111864129 CAGCTGCTGTAGGGGAAAATGGG + Intergenic
986256321 5:6103873-6103895 CAGCGGTTCTAGGGGTTAGGAGG - Intergenic
990364261 5:55053766-55053788 CAGCTGTTCTGGGGGATGGTCGG - Intergenic
992150468 5:73897355-73897377 CACCTGTTCTAGGGGATATTGGG - Intronic
992993818 5:82313128-82313150 CAGCTTCACTAGGGCTTAGATGG - Intronic
994009022 5:94878142-94878164 CAGTTTCTATAAGGGATAGATGG - Intronic
995324967 5:110880128-110880150 CAGCTGCTCTGGGAGAGAAAGGG - Intergenic
997042983 5:130279110-130279132 CAGCAGCAATAGGGAATAGAGGG + Intergenic
1000775011 5:165408737-165408759 CAGTTGCTTCAGGGGAGAGATGG - Intergenic
1002472097 5:179441492-179441514 CAGGAGCTCTAGGCTATAGACGG + Intergenic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1003464805 6:6368758-6368780 CAGCTTCTATAGGGACTAGAGGG - Intergenic
1004530937 6:16455093-16455115 CAAATGCTCTAGGAGACAGAAGG + Intronic
1006897612 6:37480934-37480956 CTGCTGCTGTGGGGGAAAGACGG - Exonic
1007309008 6:40930341-40930363 CAGCTGCACAAGGGCAAAGAGGG - Intergenic
1008341043 6:50364563-50364585 GAGCTGTTCTTGGGGATAGAAGG + Intergenic
1009960538 6:70515590-70515612 CAGGGGCTCTGGGGGACAGAGGG + Intronic
1010614075 6:77991729-77991751 CAGCTGCTGGAGAGGATAGGAGG - Intergenic
1011781480 6:90794645-90794667 CAGCTGCTCTAGGGAGTAACTGG - Intergenic
1015621780 6:135139549-135139571 AAGCTGCTAGAGGGAATAGAAGG - Intergenic
1017761435 6:157572934-157572956 CAGGTTCTCTTGGGGCTAGAGGG + Intronic
1018612477 6:165659993-165660015 AAGCTGCTCTGGGGGAAAGGTGG - Intronic
1019710139 7:2514470-2514492 CAGATGGTCTAATGGATAGATGG - Intronic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1022283174 7:28930874-28930896 CAGCTTTTCTTGGGGACAGATGG - Intergenic
1022287229 7:28965190-28965212 CTGCAGCTCTAGGGGAGGGAAGG - Intergenic
1023622621 7:42088497-42088519 CAGGTGCTCTAAGGGGTGGACGG - Intronic
1024408369 7:49009451-49009473 GACCTGCTCTAGAGGGTAGAAGG + Intergenic
1026673872 7:72412929-72412951 CAGCTGCCCCAGGAGAAAGAGGG - Intronic
1030059354 7:105610668-105610690 CACATGTTCTAGGGGAAAGAAGG + Intronic
1035587426 8:786607-786629 CAGCGGCTCTTCGGGAGAGACGG + Intergenic
1037308937 8:17534954-17534976 TAGCTGCTCTAGGGGAAGGGCGG - Intronic
1037431288 8:18815883-18815905 AAGCTGCTCTATGCGATATAGGG + Intronic
1037766230 8:21774125-21774147 GAGCTCCTCTAGGGGATTGCTGG - Intronic
1045155659 8:99467394-99467416 CACCTGATATAGGGGATAAAAGG - Exonic
1056536152 9:87529560-87529582 CACATGCTCTGGGGGATATATGG + Intronic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1060453526 9:123766447-123766469 TAGAAGCTCTAGGAGATAGATGG - Intronic
1061959978 9:133983011-133983033 CACCTGCTCTAGGAGAGAGACGG + Intronic
1186049567 X:5576388-5576410 TAGCTGCTCTATGAGCTAGAGGG + Intergenic
1190938270 X:55015717-55015739 CAACTCCTCGAGGGGACAGATGG + Exonic
1192576344 X:72246117-72246139 GAGCAGGTCTAGGGGAGAGAGGG - Intronic