ID: 1112400437

View in Genome Browser
Species Human (GRCh38)
Location 13:99072888-99072910
Sequence CTTGCAAGGCTGAAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112400431_1112400437 12 Left 1112400431 13:99072853-99072875 CCAGGCATCATGGCACACACTTA 0: 1
1: 4
2: 73
3: 865
4: 7101
Right 1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG 0: 1
1: 0
2: 6
3: 41
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112400437 Original CRISPR CTTGCAAGGCTGAAGATGGG AGG Intronic
900083205 1:874577-874599 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic
901355165 1:8640043-8640065 CTTGAGAGGCTGAAGTGGGGAGG + Intronic
901547411 1:9968829-9968851 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
901565688 1:10112957-10112979 CTTGCAAGGCGGCAGATGGGGGG - Intronic
901791626 1:11656403-11656425 CTTGGGAGGCTGAACTTGGGAGG - Intronic
901802672 1:11717885-11717907 CTTGGGAGGCTGAAGTGGGGAGG + Intronic
903157739 1:21459668-21459690 CTGGGAACGCTGAAGATGGGAGG + Intronic
904483734 1:30810331-30810353 CTTCTAAGGCAGAGGATGGGGGG - Intergenic
904596111 1:31646672-31646694 CTTGCAGGACTGGAGTTGGGAGG - Intergenic
904963677 1:34355011-34355033 TTTGCAAGGCTGAAGAGGGGTGG + Intergenic
905210015 1:36367543-36367565 GTTCCAAGGCTGAAGATGCCCGG + Intronic
905424273 1:37870599-37870621 CTTACATGGCAGAAGAGGGGAGG - Intronic
905490609 1:38340646-38340668 CTTGTAAGGCTGGAGTTGAGTGG + Intergenic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906349762 1:45048353-45048375 CTTGCACAGCTGAATATGGCTGG - Intronic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907101310 1:51839267-51839289 CTTGACAGGCTGAAGATGGGAGG - Intronic
908042164 1:60126413-60126435 TTTGGGAGGCTGAAGATGGGGGG - Intergenic
908201849 1:61805680-61805702 CTTAAAATGCTAAAGATGGGGGG - Intronic
908259777 1:62331084-62331106 CTTGGAAGGCTGAGGTTGAGAGG - Intergenic
908830055 1:68169904-68169926 CTTCCAAGGCTGGAGAGGAGAGG - Intronic
908847568 1:68340308-68340330 GTTGCAAAGATAAAGATGGGTGG + Intergenic
909543904 1:76822596-76822618 CTGGCGAGGCAGAAGATTGGAGG - Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
910882955 1:91938947-91938969 CTTGGAAGGCTGAGGTTGGAGGG + Intergenic
911996156 1:104769360-104769382 CTTGGGAGGCTGAGGTTGGGCGG + Intergenic
912032793 1:105270680-105270702 CTATGAAGGCTGAAGAAGGGAGG + Intergenic
912624179 1:111194251-111194273 CTTGCAAGGCTGAGGGAGGGTGG - Intronic
913203167 1:116512668-116512690 CTTGGAAGGCTGAACCCGGGAGG + Intergenic
913531542 1:119737432-119737454 CTATCAAGGCTGGAGACGGGAGG - Intronic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914507686 1:148303541-148303563 CTTCCAAGCCTGGAGGTGGGTGG + Intergenic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914819844 1:151092494-151092516 TTTGGAAGGCTGAGGATGGAAGG - Intronic
915247236 1:154565097-154565119 CTTGAAAGGCTTAAAATTGGTGG - Intergenic
916591926 1:166199746-166199768 GTTGCAATCCTGAAGATGGGAGG + Intergenic
917427285 1:174928083-174928105 CCTGCAAGGCTGGAGAAGGAAGG - Intronic
918605124 1:186415602-186415624 CTACCCAGGCTGAAGCTGGGAGG - Intronic
919347259 1:196399832-196399854 CTTACATGGCTGAAGAAGCGAGG - Intronic
919872591 1:201833892-201833914 CTTGGGAGGCTGAGGTTGGGAGG - Intronic
920143589 1:203839282-203839304 CTTGGGAGGCTGAAGAAGGATGG - Intronic
920640762 1:207749971-207749993 CTTCCAAGCCTGAAAATGGATGG + Intergenic
920748254 1:208649297-208649319 CTTACATGGCAGAAGATGAGAGG - Intergenic
923736064 1:236608843-236608865 CCTGGGAGGCTGAAAATGGGAGG + Intergenic
924078463 1:240366657-240366679 CTTGGAAGGCTGAACTTGGAAGG - Intronic
1062774436 10:134490-134512 CTTGCAGGGCTGCTGATGGGTGG + Exonic
1062863728 10:831533-831555 TTTCCCAGGCTGAAGATGTGGGG - Intronic
1062941565 10:1425642-1425664 CTTGAGAGGCTGTAGATGGAAGG - Intronic
1063050744 10:2444430-2444452 CTTGGGAGGCTGGAGGTGGGAGG + Intergenic
1063529837 10:6820554-6820576 CCTGCAATTCTGCAGATGGGTGG - Intergenic
1063647302 10:7897901-7897923 TTTGGGAGGCTGGAGATGGGAGG - Intronic
1063849428 10:10168173-10168195 GATGAAAGGCTGAAGATGAGGGG - Intergenic
1065705752 10:28470118-28470140 CTTGGGAGGCTGAAGTAGGGAGG + Intergenic
1067335455 10:45359145-45359167 CCTGCGAGGCTGCAGCTGGGTGG + Intergenic
1067545256 10:47188196-47188218 GTGGCAAGGCAGAAGTTGGGGGG + Intergenic
1067828982 10:49599049-49599071 TTTGGGAGGCTGAAGATGGGAGG - Intergenic
1070724358 10:78778188-78778210 CCTGCAGTGCTGAAGATGAGAGG + Intergenic
1070810614 10:79296018-79296040 ATTCCAAGGCTGAACTTGGGTGG - Intronic
1070893665 10:79963233-79963255 CTTGGCAGGCTGAATCTGGGAGG + Intronic
1071519646 10:86321524-86321546 CTTGCAAGGCAGAAGGTTGATGG + Intronic
1072219381 10:93314940-93314962 CTTGGGAGGCTGAGGTTGGGAGG + Intronic
1072501558 10:96023273-96023295 GTGGCAAGGCAGAAGATGGAGGG - Intronic
1073499832 10:103926406-103926428 CTTGCAAAGATGAAGAGGGCAGG + Intergenic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077473881 11:2777406-2777428 CTTGCAGGGCTCAAGTTGAGAGG + Intronic
1077724004 11:4655289-4655311 CATGAAAGGCTGCACATGGGAGG - Exonic
1078248346 11:9596679-9596701 CTTGGGAGGCTGAGGTTGGGAGG + Intergenic
1078321623 11:10340016-10340038 CCTGCAAGGCTGAAGCCTGGTGG + Intronic
1078638865 11:13077171-13077193 CTCGCAGGGCTGAGGAAGGGAGG + Intergenic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1081208886 11:40307435-40307457 TTTGCAAGGCAGAAGCTGGGTGG - Intronic
1081930361 11:46866387-46866409 CTTGGGAGGCTGAGGTTGGGAGG - Intronic
1082004397 11:47411812-47411834 CCTGCAAGGCTGGATATGGGTGG - Intronic
1082101268 11:48175167-48175189 CTTGGGAGGCTGAAGTGGGGGGG + Intergenic
1082882921 11:58055856-58055878 CTTACATGGCTGAAGATAGAAGG - Exonic
1083186566 11:61021237-61021259 CTTGGGAGGCTGAAGCAGGGAGG + Intergenic
1084093554 11:66895084-66895106 CTTCCAGGGCTGGAGAGGGGAGG - Intronic
1084860322 11:72013876-72013898 ACAGCAAGGCTGAAGATGAGTGG - Exonic
1085126807 11:74007537-74007559 CTCGGGAGGCTGAAGGTGGGAGG - Intronic
1086360022 11:86048958-86048980 CTTCCAATTCTGAAAATGGGAGG + Intronic
1087543422 11:99550470-99550492 CTTGAAAGGCTGAATAAGGTTGG - Intronic
1089111123 11:116057525-116057547 CTTGCAAGGCAGAAGAGGAGAGG - Intergenic
1089369058 11:117941305-117941327 CAGGCAGGGCTGAAGATGGTTGG - Intergenic
1092248887 12:6880628-6880650 CTTGGGAGGCTGAGGTTGGGGGG - Intronic
1092803618 12:12197934-12197956 CTTGGGAGGCTCAAGGTGGGAGG + Intronic
1093920631 12:24855868-24855890 TTTGAAAGGCTGAAGAAGGAGGG - Intronic
1094547333 12:31416981-31417003 CTTGGGAGGCTGAGGTTGGGAGG + Intronic
1094813693 12:34164516-34164538 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1095103222 12:38203993-38204015 CCTGCAAGGCTGAAGTTGTCTGG + Intergenic
1095210333 12:39486383-39486405 CTTGCAAGTCTGAAGTTTGTAGG - Intergenic
1096863350 12:54546249-54546271 CTTGGAAGGCTGAGGTGGGGAGG + Exonic
1097233342 12:57525161-57525183 CTTGGAAGGCTGGTGGTGGGAGG + Intronic
1098269353 12:68754835-68754857 CTTGGGAGGCTGAGGTTGGGGGG - Intronic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098651466 12:72975944-72975966 ATTGCAAAACTGCAGATGGGAGG + Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1099163672 12:79275434-79275456 CTTGCAAGCCTGAACCTGGAGGG - Intronic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1102950643 12:117028511-117028533 CCTGCAGGGCTGGAGCTGGGAGG - Exonic
1103013803 12:117478540-117478562 CTTCATAGGCTGAAGATGGGAGG - Intronic
1103885893 12:124199953-124199975 CTGTCAAGGCTGGGGATGGGTGG - Intronic
1104793244 12:131497428-131497450 CCTTCAAGGCTGAAGCAGGGGGG - Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105402667 13:20109647-20109669 CTACCAAGGCTGGAGAGGGGAGG - Intergenic
1106295454 13:28409440-28409462 CTCGGAAGGCTGAAGTTGGAGGG - Intronic
1106366500 13:29085917-29085939 TTGGCAAGGCTGAAGATGAAAGG - Intronic
1106474124 13:30082715-30082737 CTTGCTAGGCTTAAGATGAAAGG - Intergenic
1106526787 13:30547807-30547829 CTTGGGAGGCTGAAGCAGGGAGG + Intronic
1107188798 13:37555109-37555131 CTTGGAAGGGTGAAGATTGGGGG + Intergenic
1108584657 13:51859998-51860020 CTTGGAAGGCTGAGGAAGGAAGG - Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1112249115 13:97762617-97762639 CTTACAAGGCTGCAGGGGGGCGG + Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1113757401 13:112822804-112822826 CTGGAAAGGCTAAAGAGGGGTGG - Intronic
1114511540 14:23266064-23266086 CTTGGGAGGCTGAACCTGGGAGG - Intronic
1114819480 14:26000126-26000148 CTTGGAAGGCTGAGGTGGGGAGG + Intergenic
1115213641 14:30992931-30992953 CTCAGAAGGCTGAAGTTGGGAGG - Intronic
1115259210 14:31436347-31436369 ATTGAGAGGCTGAAGAGGGGTGG - Intronic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1115482863 14:33879179-33879201 CTTGGAAGGCTGAAGTGGGAGGG + Intergenic
1115998147 14:39214608-39214630 CTTGGGAGGCTTGAGATGGGAGG + Intergenic
1117394537 14:55296043-55296065 CTTGTGAGGCTGAGGTTGGGAGG + Intronic
1117514315 14:56485398-56485420 CTTACATGGCAGAAGATGGAAGG + Intergenic
1117733932 14:58750939-58750961 CTTCCAAGCCTGCAGGTGGGAGG - Intergenic
1117965107 14:61198972-61198994 CTTGCAAGGCTGAGGGATGGGGG + Intronic
1118087517 14:62434890-62434912 CTTGGAAGGCTGAGGAAGGGGGG - Intergenic
1118214296 14:63793828-63793850 CTTGAGAGGCTGAGGTTGGGAGG + Intergenic
1118631641 14:67709700-67709722 CTACCAGGCCTGAAGATGGGGGG + Intronic
1119372979 14:74163780-74163802 CTTCAAAGGCTGAAGATTGGTGG + Intronic
1120421380 14:84290551-84290573 CTTGAAAGGCAAAAGCTGGGCGG - Intergenic
1120909280 14:89651016-89651038 CTTGGGAGGCTGGAGTTGGGAGG + Intergenic
1121094449 14:91206155-91206177 CGTGGAAGGCTGAAGAAAGGTGG - Intronic
1121304716 14:92898888-92898910 CTGGGAAGGCTGGAGGTGGGTGG - Intergenic
1121329005 14:93038140-93038162 CTTGGGAGGCTGAACCTGGGAGG - Intronic
1121767418 14:96500158-96500180 CTTGGGAGGCTGAGGTTGGGAGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122587321 14:102817983-102818005 CTGGGAAGGCTGGAGAGGGGTGG + Intronic
1124254708 15:28131253-28131275 CTTCCAAGGCTGAGGATGCTGGG - Intronic
1125382410 15:39100827-39100849 GTTGGAAGGATGAAGATGGTGGG + Intergenic
1126007409 15:44271313-44271335 CCTGCAAGTCTGTAGATGGCAGG - Intergenic
1127446973 15:59073062-59073084 CTTGGGAGGCTGAAGTTGGGAGG + Intronic
1127528298 15:59816124-59816146 CATGCAAGGGTGGAGATGGAAGG + Intergenic
1128276562 15:66358657-66358679 CTTGGGAGGCTGAGGAGGGGAGG - Intronic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1129084011 15:73069059-73069081 CTTGGGAGGCTGAAGGGGGGAGG - Intronic
1129161393 15:73749954-73749976 CTAGGAAGGCTGAAGAGGTGGGG - Intronic
1129418321 15:75402088-75402110 CTTGGGAGGCTGAGGATGGGAGG - Intronic
1131084711 15:89566627-89566649 CTAGGAAGGCTGAGGAAGGGTGG - Intergenic
1131480131 15:92773580-92773602 CATACAAGGCAGAAGCTGGGTGG - Intronic
1132222249 15:100113698-100113720 GTTGCAAAGCTGAAGATGTCAGG - Intronic
1133873332 16:9710113-9710135 TGTGGAAGGCGGAAGATGGGAGG - Intergenic
1136059157 16:27712911-27712933 CTTGAGAGGCTGAGGTTGGGGGG - Intronic
1140166352 16:72555839-72555861 CTTGGAAGGCTGAGGTGGGGAGG + Intergenic
1140635502 16:76908269-76908291 CTCAGAAGGCTGAAAATGGGAGG + Intergenic
1141354979 16:83336985-83337007 CTTTCATGGCTGAAGATGAGAGG + Intronic
1144165114 17:12603126-12603148 CTTGCAAGACTGGAGATTTGGGG - Intergenic
1144367314 17:14556847-14556869 CTAGCAAGGCTGCAGGTAGGGGG + Intergenic
1145743954 17:27299266-27299288 TTTGGGAGGCTGAAGGTGGGAGG + Intronic
1146637899 17:34519598-34519620 CTTGCAGGGCATGAGATGGGCGG - Intergenic
1146819912 17:35976589-35976611 CCTGCAAAGCTTAACATGGGAGG + Exonic
1148002047 17:44394600-44394622 CTTGAAAGGCTGAGGTTGAGAGG + Intergenic
1148989845 17:51656265-51656287 CTTGCAAGGCAGAAAAAGGCAGG + Intronic
1149265932 17:54927675-54927697 CTTGCAGGGCTGTGGATGTGGGG - Intronic
1149525341 17:57351188-57351210 CTTGCAAGGCACAAGCAGGGAGG + Intronic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1151406588 17:73891430-73891452 CTTGCAAGGCTACAGATGTTTGG - Intergenic
1151836972 17:76588148-76588170 CCTGTGAGGCTGAAGATGGGAGG - Intergenic
1153038300 18:785827-785849 CTTGGGAGGCTGAAGTAGGGAGG + Intronic
1153243875 18:3054861-3054883 TTTGGGAGGCTGGAGATGGGTGG - Intergenic
1153360363 18:4188408-4188430 CATGCAAGGCTTAAGATGACGGG - Intronic
1153645644 18:7193800-7193822 AATGCAAGGCTGAAGTTAGGCGG + Intergenic
1153679187 18:7484339-7484361 CACGTAAGGGTGAAGATGGGAGG - Intergenic
1153843511 18:9028297-9028319 CTTGCTGTCCTGAAGATGGGAGG - Intergenic
1154009612 18:10563875-10563897 TTTGCCAGGCTGAGGCTGGGTGG + Intergenic
1155136332 18:22996887-22996909 CTTGGGAGGCTGAGGTTGGGAGG + Intronic
1155491252 18:26404133-26404155 CTTGGAAGGCTGAAGTTGGGGGG - Intergenic
1155628737 18:27865960-27865982 CTATGAATGCTGAAGATGGGTGG + Intergenic
1156395240 18:36693350-36693372 CTTGAGAGTCTGAAGATGAGGGG - Exonic
1156395841 18:36699131-36699153 CTTGCAAGACTGAAGAAACGTGG + Intronic
1157757103 18:50228545-50228567 CTTGGGAGGCTGAGGTTGGGTGG + Intronic
1157865939 18:51184748-51184770 CTTGGGAGGCTGAGGTTGGGAGG + Intronic
1157906956 18:51577755-51577777 CTTACATGGCAGAAGAAGGGAGG + Intergenic
1159908236 18:74118103-74118125 CTTGAGAGGCTGAGGGTGGGAGG - Intronic
1162023896 19:7882597-7882619 CTTGGGAGGCTGAAGTGGGGAGG + Intergenic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1163548143 19:17951235-17951257 CCACCAAGGCTGAAGGTGGGTGG + Intergenic
1163711729 19:18851121-18851143 CTTGCCGGGGTGAGGATGGGTGG + Intronic
1163844074 19:19628655-19628677 CTGGCAAAGCCGAAGCTGGGCGG - Exonic
1165928019 19:39339280-39339302 CTTGGGAGGCTGAGGTTGGGAGG + Intronic
1166533323 19:43555383-43555405 TTTGCAAGGCTGCAGGAGGGAGG + Intronic
1166691099 19:44821494-44821516 CTTGCAAGGGGGCGGATGGGGGG - Intergenic
1167595018 19:50422936-50422958 CCTGCAGGGCTGTAGGTGGGGGG - Exonic
1167615490 19:50530604-50530626 CTCGCAAGGCTGACGTTGTGAGG - Intronic
1168445768 19:56411180-56411202 CTTGAGAGGCTGAGGTTGGGAGG + Intronic
927501843 2:23588390-23588412 CCTGGGAGGCTGAAGGTGGGTGG - Intronic
929138828 2:38649812-38649834 CTTGGGAGGCTGAGGAAGGGTGG - Intergenic
929226923 2:39520891-39520913 CTTACATGGCTGGAGAAGGGGGG + Intergenic
929666160 2:43835729-43835751 CTTGCATGGCAGAAGTGGGGAGG - Intronic
930819885 2:55634995-55635017 CTTGGAAGGCTGAAGTGGGAAGG - Exonic
931350685 2:61485478-61485500 CTCGAAAGGCTGAAGTGGGGGGG - Intronic
933515257 2:83292258-83292280 CTTGCAAGTCTGAACATGGAGGG + Intergenic
934692283 2:96370894-96370916 CTTGCATGGCTGCTGTTGGGGGG + Intronic
934911057 2:98254849-98254871 CTTACCAGGCTCATGATGGGAGG + Intronic
935168814 2:100593618-100593640 CTTGCATAGCTAAAGAGGGGAGG - Intergenic
935710274 2:105892591-105892613 TTTGGAAGGCTGAGGCTGGGAGG + Intronic
935785306 2:106543420-106543442 CTTGGGAGGCTGAGGATTGGAGG + Intergenic
935949777 2:108318098-108318120 CTTGGGAGGCTGGAGGTGGGAGG - Intergenic
936345861 2:111674404-111674426 TTTGGAAGGCTGAGGGTGGGTGG + Intergenic
936577072 2:113666138-113666160 CTTGTGAGACTGAAGATGGCAGG - Intergenic
936775339 2:115965742-115965764 CCTGCAAGGCTGCAGCCGGGCGG - Intergenic
936879352 2:117231783-117231805 CATGCAAGCCTGAACCTGGGGGG + Intergenic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937222690 2:120350895-120350917 CTTGAACTGCTGAGGATGGGGGG + Exonic
937413965 2:121699684-121699706 CTTGCAAGGCTGAGGGAGGTGGG - Intergenic
938936182 2:136129506-136129528 ATTGCAAGGCTGCTAATGGGTGG + Intergenic
941422315 2:165298018-165298040 CTTGGAAGACTGAAGCTGTGTGG + Intronic
942486760 2:176447989-176448011 CTTGAGAGACTGAAGATGGGTGG + Intergenic
942548933 2:177094232-177094254 CTTGAAAGACTGAAAATGTGAGG - Intergenic
942749025 2:179267196-179267218 TTTACAAGGCTGCATATGGGGGG - Intergenic
942911335 2:181247636-181247658 TTTCCAAGCCTGAAGATTGGAGG - Intergenic
942986988 2:182155193-182155215 CTTGGGAGTCTGAAGTTGGGAGG - Intronic
944574126 2:201074750-201074772 CTAGAAAGGCTGAACATGGCTGG - Intronic
946097034 2:217283551-217283573 CTTGCAAGGGTGAGGAGTGGTGG + Intergenic
947100357 2:226614241-226614263 CTTTCAAGGCTGAAGTCTGGTGG + Intergenic
947359615 2:229334072-229334094 CTTGGGAGGCTGAACCTGGGAGG - Intergenic
947666524 2:231909462-231909484 CTTGGGAGGCTGAACCTGGGAGG - Intergenic
948414598 2:237793623-237793645 CTTGGGAGGCTGAACCTGGGAGG + Intronic
948802229 2:240438163-240438185 CTTGCAAGTCTGGAGGAGGGTGG - Intronic
949007532 2:241658257-241658279 GCTGCAGTGCTGAAGATGGGAGG - Intronic
1168954596 20:1826205-1826227 GCTGGAAGGCTGCAGATGGGTGG - Intergenic
1170273140 20:14550463-14550485 CTCGCATGGCTGAAGAGGGAGGG - Intronic
1172771040 20:37382801-37382823 CTATCAGGGCTCAAGATGGGTGG + Intronic
1174478505 20:50814392-50814414 CTTGAGAGGCTGAGGTTGGGAGG - Intronic
1174484917 20:50855112-50855134 AATGGAGGGCTGAAGATGGGAGG - Intronic
1174856100 20:54046930-54046952 CTTGAAAGGATGAAGATGGCTGG + Intronic
1174941019 20:54927230-54927252 CTTGAAAAGCTGAATATGGCTGG - Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176006706 20:62868418-62868440 CTTGGGAGGCTGGAGGTGGGAGG + Intergenic
1177337449 21:19749883-19749905 CTTGCAAGACTGGAGCTTGGAGG - Intergenic
1180121554 21:45752888-45752910 TTTGGGAGGCTGAAGATGAGAGG + Intronic
1180725992 22:17946926-17946948 CTTCCAAGCCGGAAGATGGGTGG + Intronic
1181572434 22:23774873-23774895 CTTGCAATCCAGAAAATGGGAGG - Intronic
1182140164 22:27947935-27947957 CTTGAAAGGCTGACGAAGGAGGG + Intergenic
1185423167 22:50746538-50746560 CTTGTGAGACTGAAGATGGCAGG + Intergenic
949541402 3:5034853-5034875 CTTGGGAGGCTGAGGAGGGGAGG + Intergenic
951421007 3:22484664-22484686 CTTGCAATGCTGAAAATGAGAGG - Intergenic
952212337 3:31240870-31240892 CTTTCAAGGCTGAAAATGAAGGG + Intergenic
953063745 3:39450386-39450408 CTTGGAAGGCTGAAGTGGGAGGG - Intergenic
954670760 3:52290254-52290276 CTTGCAAGGCAAAAGACAGGAGG - Intronic
954773430 3:52995496-52995518 CTTGGTAGGCTGAGAATGGGAGG - Intronic
954776557 3:53024220-53024242 CTTCCAAGTCTGGAGGTGGGTGG + Intronic
954902040 3:54028105-54028127 CAAGCATGGCTGAAGCTGGGTGG - Intergenic
957346068 3:78963114-78963136 CTTGCAATGCTGATGATAGGAGG + Intronic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
958927149 3:100171341-100171363 CTTGAAAGGGGGAAGAGGGGGGG - Intronic
960224110 3:115148686-115148708 CTTACAAGGGCCAAGATGGGAGG + Intergenic
960280938 3:115780813-115780835 GTTGCAAGGCTAGACATGGGGGG + Intergenic
960749915 3:120937072-120937094 CCTGGAAGGCTGGAGATGGCTGG + Intronic
961228746 3:125280571-125280593 CTTGGGAGGCTGAGGATGGGAGG + Intronic
961848884 3:129794817-129794839 CTGGGACGGCTGAAGAGGGGAGG - Intronic
962032182 3:131612658-131612680 CTTGCATGGATGAAGATAAGAGG - Intronic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
962167594 3:133065800-133065822 TTTTCAAGGCTTAAAATGGGTGG + Intronic
962888664 3:139652013-139652035 CTGGCAGGCCTGAAGCTGGGTGG - Intronic
963629110 3:147711486-147711508 CTTGCAAGCCAGAAGAGTGGAGG - Intergenic
964049672 3:152375080-152375102 CTTGGGAGGCTGAAGAAGGAAGG - Intronic
964245200 3:154643709-154643731 TTTGAAAGGCTGAAGAGGGCAGG + Intergenic
965681995 3:171261155-171261177 CTTGTATGGGTGAAGGTGGGAGG - Intronic
966135502 3:176693715-176693737 CTTGAAAGGCAGAAGAGGAGTGG - Intergenic
966162451 3:176982922-176982944 CTAGCAAGGCTGAAGTGGGTGGG - Intergenic
967132081 3:186480413-186480435 CTTGTGAGGCTGAGGTTGGGAGG + Intergenic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
967993193 3:195146945-195146967 CTTGGAAGGCTGAGGCAGGGGGG - Intronic
968761473 4:2444514-2444536 CTTGATAGGCTGATGATGGTGGG + Intronic
970329146 4:14961388-14961410 ATTGCCAGCCTGAAGATGGAGGG - Intergenic
970612635 4:17739796-17739818 CTTGCAAGGCTGAGGCAGGTGGG - Intronic
972735898 4:41840967-41840989 CTTGAAGGGCTGGAGATGAGAGG - Intergenic
974080021 4:57202546-57202568 CTCAGGAGGCTGAAGATGGGAGG + Intergenic
974444722 4:61965103-61965125 CTTGGGAGGCTGAAGAGGGAGGG - Intronic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
977324030 4:95552382-95552404 CTTGAGAGGCTGAAGAGGAGAGG - Intergenic
977352685 4:95908125-95908147 ATTGTAAGTCTGAGGATGGGAGG - Intergenic
977630409 4:99236498-99236520 CATGCATGGCTGTAGATGTGGGG - Intergenic
978274279 4:106930611-106930633 CTTGCAAGAATCCAGATGGGTGG - Intronic
979539240 4:121861627-121861649 ATTGCAAGGCTGGAACTGGGAGG - Exonic
980480873 4:133385490-133385512 CTTGCAAGGCTGCAGCTGGAGGG - Intergenic
981328042 4:143474757-143474779 CTGGCAAGTCTGAAGTTGGTAGG - Intergenic
981543271 4:145868012-145868034 CTTGCAAGAATGAAGATGTTAGG - Intronic
981723251 4:147822558-147822580 CGTGCCAGGTTGAAGATGGCGGG + Intronic
981892907 4:149760071-149760093 ATGGCAAGGCTGAAGATGATGGG + Intergenic
982404966 4:155009237-155009259 CTAACAAGGCTGAGGGTGGGTGG + Intergenic
984350625 4:178587724-178587746 TTTGGGAGGCTGGAGATGGGAGG + Intergenic
984995908 4:185429776-185429798 CTCAGGAGGCTGAAGATGGGAGG - Intronic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985955874 5:3266026-3266048 CTTGCAAGGGTGAAGGAGTGAGG + Intergenic
987162167 5:15155710-15155732 TTTGCAAGCCTGAGGATGGCTGG + Intergenic
987961315 5:24813153-24813175 TTTGGGAGGCTGGAGATGGGCGG - Intergenic
988905619 5:35785639-35785661 CTTGGAAGGCTGAGGTGGGGGGG - Intronic
992444554 5:76821821-76821843 TTTGGGAGGCTGAAGGTGGGTGG - Intronic
992444898 5:76824434-76824456 CTTGGGAGGCTGAACCTGGGAGG - Intronic
994402648 5:99300875-99300897 CTTCAAAGGCTGAGGCTGGGAGG - Intergenic
994902490 5:105793557-105793579 CTTGGTAGGCTGAGGTTGGGAGG - Intergenic
996109054 5:119543259-119543281 GTTGCAGGGGTGAAGGTGGGAGG - Intronic
997509233 5:134441987-134442009 CCTGCAAGGCTGGAGAGAGGAGG + Intergenic
998008365 5:138672719-138672741 CTTGGAAGGCTGAGCCTGGGAGG + Intronic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
999254754 5:150204131-150204153 CTTGCAAAGAGGAAGATGGAGGG - Intronic
1003622080 6:7709226-7709248 CTGGCAAGGATGAAGACTGGAGG - Intergenic
1004184828 6:13412948-13412970 CTTGAAAGACTGAAGATGCTGGG - Intronic
1004469141 6:15913257-15913279 CTTGGGAGGCTGAGGTTGGGAGG + Intergenic
1004690882 6:17991038-17991060 CTTGGGAGGCTGAAGCAGGGGGG + Intergenic
1004742234 6:18473126-18473148 GTTGCAAGCTTGAAGATGGAGGG - Intergenic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1009744682 6:67797871-67797893 CTTGCAAGGAGGATGATTGGTGG - Intergenic
1009751742 6:67885048-67885070 GTTGAGAGGCTGCAGATGGGGGG + Intergenic
1009898578 6:69783480-69783502 CTTGGAAGCCTGAAGGTGGGAGG - Intronic
1010213655 6:73382942-73382964 CTTGGAAGGCTGAGCCTGGGAGG - Intronic
1010229415 6:73521524-73521546 ATGGCAAGGCTGAGGACGGGAGG - Intronic
1011490846 6:87890298-87890320 CTTGCAAGGGAGAAGAAAGGAGG + Intergenic
1011499356 6:87970653-87970675 ATTGCAAGATTGTAGATGGGAGG + Intergenic
1013953833 6:115817859-115817881 TTTGGAAGGCTGAAGGGGGGTGG + Intergenic
1016924270 6:149326789-149326811 AAAGCAAGGCTGAGGATGGGTGG - Intronic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1018396061 6:163378869-163378891 CTTGAGAGGCTGAGGCTGGGAGG + Intergenic
1018517991 6:164609172-164609194 CTGGCAAGGATGCAGATGAGAGG + Intergenic
1018671587 6:166182217-166182239 CTTGGGAGGCTGAAGCTGGTGGG + Intergenic
1020220048 7:6229430-6229452 CTTGTAAGGGTGCAGTTGGGCGG - Intronic
1020864026 7:13533596-13533618 CTTCAGAGGCTGAGGATGGGAGG - Intergenic
1020869827 7:13613635-13613657 CTTGGAAGGGTGAAGACGTGAGG + Intergenic
1021616602 7:22508272-22508294 CTTGCAGGGCTGAGAGTGGGAGG - Intronic
1022926407 7:35059485-35059507 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1023466180 7:40457638-40457660 CTGGCATAGCTGAAGATGGAAGG + Intronic
1024087887 7:45911818-45911840 CTTCCAAGGCTGCAGATGAGGGG + Intergenic
1027387074 7:77669236-77669258 CTTGGGAAGCTGAAGTTGGGGGG + Intergenic
1027520635 7:79202259-79202281 CTACCAAGACTGGAGATGGGTGG + Intronic
1028375857 7:90146066-90146088 CTTGCAGGGCTGAGAGTGGGAGG + Intergenic
1028989242 7:97032510-97032532 ATTGCAAGGATGGTGATGGGAGG - Intergenic
1029824410 7:103174170-103174192 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1030577307 7:111305137-111305159 CTTGCAAGGGTTAAGAAGAGTGG + Intronic
1030958409 7:115884849-115884871 ATTGGAAGGATGAACATGGGAGG + Intergenic
1031390367 7:121206060-121206082 ATTTCAAGGCAGAAGAAGGGAGG - Intronic
1032203414 7:129840292-129840314 CTTGGAAGACTGAGGCTGGGAGG - Intronic
1033928195 7:146489716-146489738 ATTCGAAGGGTGAAGATGGGTGG + Intronic
1034195917 7:149247215-149247237 CTTGGGAGGCTGAGGATGGGAGG - Intronic
1035006210 7:155662925-155662947 GTTTCAAGGATGAAGAGGGGTGG + Intronic
1035334946 7:158121801-158121823 CTTGCCAGGCTGAGGAAGGAAGG - Intronic
1035543098 8:457409-457431 CGTGCCAGGCTGAGGAAGGGTGG - Intronic
1036773504 8:11594285-11594307 CTTTCAAGGCTGCTGATGGATGG + Intergenic
1037442323 8:18928923-18928945 CTTGGGAGGCTGGAGGTGGGAGG - Intronic
1037741978 8:21615571-21615593 GTCGCAAGGCAGAAGAAGGGAGG - Intergenic
1037946051 8:22990369-22990391 CTTGCAGGCCTGCAGCTGGGAGG + Intronic
1038041019 8:23724306-23724328 TTTGCAAGGCTGAAGCAGGAGGG - Intergenic
1038574311 8:28690976-28690998 ATTGCAGGGGTGAAGTTGGGGGG + Intronic
1039346220 8:36708501-36708523 ATTGCAAGGCTAAAGAAGAGAGG + Intergenic
1042935511 8:74054268-74054290 TTTGGAAGGCTTAAGGTGGGAGG - Intergenic
1043705458 8:83343366-83343388 CTTACATGGCTGAAGATGGAAGG - Intergenic
1044091050 8:88001879-88001901 CTTGTAATGATGAAGATGTGGGG - Intergenic
1045092536 8:98761230-98761252 CTTGGGAGGCTGAGGTTGGGAGG - Intronic
1045403523 8:101842458-101842480 CTAACAAGTCTGAATATGGGTGG + Intronic
1046143266 8:110122039-110122061 TTTGCAAGGCCATAGATGGGAGG + Intergenic
1046949238 8:120003905-120003927 CTTGCCAGGATGAGGATGTGTGG + Intronic
1047424389 8:124731898-124731920 GTAGCAAGGCTGAAGGGGGGTGG - Intergenic
1048015825 8:130496838-130496860 CTAGCAGGGCTGAAGATGAGGGG + Intergenic
1049473807 8:142787788-142787810 CTGGCTAGGCTGAAGGTGAGTGG + Intergenic
1050175332 9:2864182-2864204 CTTGGAAGGCAGAGGATGGGAGG + Intergenic
1050350335 9:4735149-4735171 CTTGAGAGGCTAAAGAGGGGAGG + Intronic
1050827983 9:9973362-9973384 CTTGGAAGGCTGAAGCCGGAGGG + Intronic
1051367609 9:16332256-16332278 CTTGCATGGCAGAAGTGGGGAGG - Intergenic
1051425228 9:16925632-16925654 CTTGAAAGGCTGAAGTGGGAGGG + Intergenic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1053348414 9:37395199-37395221 CTGGCAGGGGTGAAGATGTGTGG - Intergenic
1055022757 9:71687756-71687778 CTTGGAAGGCTGAAGTAGGAGGG + Intronic
1055664251 9:78537888-78537910 ATTGGGAGGCAGAAGATGGGAGG - Intergenic
1056146309 9:83733287-83733309 CTTGCAAAGCTGAAGATTCATGG - Intergenic
1056816605 9:89806323-89806345 CTAGGGAGTCTGAAGATGGGTGG + Intergenic
1057757586 9:97850168-97850190 CTTGAAGGGCTGAAGATCAGTGG + Intergenic
1058624430 9:106919768-106919790 CTTGCAGGGATCATGATGGGTGG + Intronic
1059242229 9:112816454-112816476 TTTGCAAGGGTGAAGATGTGGGG - Intronic
1060405256 9:123369831-123369853 CTGGTAAGGCAGGAGATGGGGGG + Intronic
1061901703 9:133675983-133676005 CTTGGAAGGCTGAAGGGGGGAGG + Intronic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186208653 X:7226784-7226806 CTTGGGAGGCTGAGGTTGGGAGG + Intronic
1186881602 X:13872276-13872298 CGTGGAAGGCTGAAGGTGGGAGG - Intronic
1188571039 X:31585213-31585235 CTTGGGAGGCTGAGGTTGGGGGG + Intronic
1188985394 X:36764265-36764287 CTTGAAAGAATGAACATGGGTGG - Intergenic
1189681127 X:43517809-43517831 CTTGCAAAGCTGAAGATCCAGGG + Intergenic
1189894760 X:45643492-45643514 CTTGAATGGCTGAGGAAGGGTGG + Intergenic
1192345300 X:70298339-70298361 CTTGGAAGGCTGAGGTGGGGTGG - Intronic
1193120254 X:77815910-77815932 CTTGAGAGTCTGAAGGTGGGAGG - Intergenic
1193135286 X:77964359-77964381 ATTGAAAGGCTGCAGATGGATGG + Intronic
1193144640 X:78064328-78064350 CTTGCAAGGGTGTGGGTGGGGGG - Intergenic
1193184887 X:78500748-78500770 CTTGCAAGGGGGAAGATTGGTGG - Intergenic
1193893645 X:87083255-87083277 CTTGCAGGGTTTAAGATGAGGGG - Intergenic
1194090056 X:89574810-89574832 CATGCAAGGCTGAACCTGGAGGG + Intergenic
1194093181 X:89602894-89602916 CTTGGGAGGCTGAGGTTGGGGGG + Intergenic
1195619225 X:106936324-106936346 ATTGGAAAGCTGAAGATGTGTGG - Intronic
1196826502 X:119744390-119744412 CTTGCAGGGCTGAGGTGGGGAGG + Intergenic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1198555999 X:137793779-137793801 CCTACAAGCCAGAAGATGGGGGG + Intergenic
1198567854 X:137923358-137923380 CTTGCAGGGATGAAGTAGGGAGG + Intergenic
1200707667 Y:6456594-6456616 CCTGCGAGGCTCAGGATGGGTGG - Intergenic
1201026445 Y:9708114-9708136 CCTGCGAGGCTCAGGATGGGTGG + Intergenic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1201758789 Y:17516575-17516597 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1201842766 Y:18389415-18389437 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic
1202052796 Y:20798227-20798249 CTCTCAAGGCTGGAGATGGAAGG - Intergenic