ID: 1112414516

View in Genome Browser
Species Human (GRCh38)
Location 13:99193260-99193282
Sequence CACAGCTCCCATTTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112414514_1112414516 11 Left 1112414514 13:99193226-99193248 CCAAATATGCAGCTGGAAATACT No data
Right 1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG No data
1112414513_1112414516 12 Left 1112414513 13:99193225-99193247 CCCAAATATGCAGCTGGAAATAC No data
Right 1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG No data
1112414511_1112414516 20 Left 1112414511 13:99193217-99193239 CCTTTTCACCCAAATATGCAGCT No data
Right 1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112414516 Original CRISPR CACAGCTCCCATTTTAAAGG AGG Intergenic
No off target data available for this crispr