ID: 1112415506

View in Genome Browser
Species Human (GRCh38)
Location 13:99200732-99200754
Sequence GTCAGGGGCGTGCGCCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415506_1112415517 25 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415506_1112415515 17 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415506_1112415510 -8 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415510 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1112415506_1112415514 10 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415506_1112415508 -9 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415506 Original CRISPR GTCAGGGGCGTGCGCCCGCT GGG (reversed) Intergenic
900199670 1:1398856-1398878 GTCAGGGGCATGGGCTGGCTAGG + Intronic
900522326 1:3111636-3111658 GTCAGGGGCGCACGCCCCCTGGG + Intronic
901086439 1:6614476-6614498 GCCAGGGGCGGGCGGCGGCTCGG - Intronic
901636006 1:10670425-10670447 GTCAGGGGCGGGCGGCTGCCGGG + Intronic
904476841 1:30770496-30770518 GTCAGGGGCGTGTGCCTCATAGG + Intergenic
905789820 1:40784033-40784055 GTCCGGGGCGGGGGCGCGCTCGG - Exonic
907766976 1:57422506-57422528 GTCTGGGGTGCGCGCCCGCGTGG - Intronic
909971962 1:82001604-82001626 CTCAGAGGCCTGCTCCCGCTTGG - Intergenic
915312562 1:155011747-155011769 GTCAGGGGACTGGGCCCTCTGGG + Intronic
1070791095 10:79189957-79189979 GGGAGGGGCGTGCGTCAGCTGGG - Intronic
1072700887 10:97640771-97640793 GTCCGGGGGTTGGGCCCGCTCGG - Exonic
1089609929 11:119663475-119663497 GTGAGGGGGGTGGGGCCGCTAGG - Exonic
1104965922 12:132508832-132508854 GTCAGGTGCGTGGCCCAGCTGGG + Intronic
1112415506 13:99200732-99200754 GTCAGGGGCGTGCGCCCGCTGGG - Intergenic
1113656849 13:112072858-112072880 GGCAGGGGGGTGCGCCCGGGAGG - Intergenic
1114402929 14:22426493-22426515 GTCAGGGGAGTGAGCCATCTCGG - Intergenic
1117962820 14:61179585-61179607 GGCAGGGGTGTGGGCCTGCTTGG + Intergenic
1118320327 14:64748963-64748985 GTAAGGGGCCTGTGCCCCCTCGG + Exonic
1128374243 15:67064559-67064581 TTCAGGGGCGTCTGCCCGCAGGG - Intronic
1129326348 15:74802134-74802156 GGCAGGGGCGTGAGCCTCCTTGG + Intronic
1131281108 15:91022217-91022239 CTCAGGGGCGTCCGGCCGATGGG + Exonic
1132525084 16:410490-410512 GTCAGGGGGAGGCCCCCGCTGGG - Intronic
1132641431 16:980283-980305 GACGGGGGCGGGCGGCCGCTGGG + Intronic
1133040908 16:3059339-3059361 TTCAGGGGCGCACGCGCGCTGGG + Exonic
1133211162 16:4264075-4264097 TTCAGGGGCATGAGCCCCCTTGG - Intronic
1135479801 16:22813594-22813616 GTCCAGGGCGTGCGTGCGCTCGG + Intergenic
1138718304 16:59049050-59049072 GGCAGGGTCGTGCTCCCTCTAGG - Intergenic
1139435732 16:66935489-66935511 GTCAGCGGGGTGCGCTGGCTTGG - Exonic
1147402862 17:40191539-40191561 GTCAGGGGCGGGCGGCGGCGCGG - Intronic
1148760407 17:49996970-49996992 GGCAGGGGTGAGTGCCCGCTTGG + Intergenic
1158579668 18:58671050-58671072 GTCAGGGGAGAGCGCTCGCCGGG + Intergenic
1160691094 19:460962-460984 GCCGGGGGCGCGCGCCCGCCCGG + Exonic
1160990107 19:1856971-1856993 GGCAGGGGCGCGCAGCCGCTGGG + Intronic
1163262213 19:16198108-16198130 GGCAGGGGCCTCCGCCCGCGGGG + Intronic
1163358351 19:16829585-16829607 GTGAGGGGCGCCCGCCCGCGGGG - Intronic
1165148723 19:33748966-33748988 CTCAGGGGTGTGCGCCTGTTGGG - Intronic
924968548 2:101184-101206 GCCAGGGGCCTCCGCCTGCTGGG - Intergenic
926312014 2:11681901-11681923 GTCAGGGGCGTGCGCTCCAAAGG - Intronic
934746163 2:96761012-96761034 GGCGGGGGCGGGCGCCCGGTCGG + Exonic
940282310 2:152000773-152000795 GTCAGGGGCGTGTGAGTGCTGGG - Intronic
1172223781 20:33290935-33290957 GTCAGGTGCCTCCACCCGCTAGG + Exonic
951981776 3:28575178-28575200 GCCCGGGGCGGGCGCCAGCTGGG - Intergenic
961531745 3:127544328-127544350 GCCAGGTGCGTGAGGCCGCTCGG - Intergenic
968977144 4:3827890-3827912 GTCAGGGGCCTGGGCTCCCTGGG - Intergenic
969539651 4:7779160-7779182 GTCAGCTGCCTGCGCCAGCTTGG - Intronic
982281030 4:153684078-153684100 GTCAAGGGCGGGAGCCTGCTGGG + Intergenic
1001539306 5:172526256-172526278 ATCAGGGGTGTGTTCCCGCTGGG + Intergenic
1005582972 6:27251159-27251181 GTCAAGGGACTCCGCCCGCTGGG - Intronic
1019154537 6:170030207-170030229 GACAGGGGCATGGGCCAGCTTGG - Intergenic
1024247221 7:47479576-47479598 GTCCGGGGCGGGCGCCTGCCTGG - Intronic
1040495210 8:47960141-47960163 CTCCCGCGCGTGCGCCCGCTCGG + Exonic
1057716622 9:97501442-97501464 GGCAGGGGCCCGCGCTCGCTCGG + Intronic