ID: 1112415507

View in Genome Browser
Species Human (GRCh38)
Location 13:99200733-99200755
Sequence AGTCAGGGGCGTGCGCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415507_1112415515 16 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415507_1112415518 30 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415507_1112415514 9 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415507_1112415508 -10 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415507_1112415510 -9 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415510 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1112415507_1112415517 24 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415507 Original CRISPR AGTCAGGGGCGTGCGCCCGC TGG (reversed) Intergenic
900522325 1:3111635-3111657 GGTCAGGGGCGCACGCCCCCTGG + Intronic
901636005 1:10670424-10670446 AGTCAGGGGCGGGCGGCTGCCGG + Intronic
901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG + Intronic
916683841 1:167127089-167127111 AGACAGGGGAATGCTCCCGCTGG - Exonic
923339615 1:232996252-232996274 AGTCAGGGGGGTGTGGCTGCGGG - Intronic
923680361 1:236113773-236113795 AGGCAGGGCCGTGCACCCTCTGG + Intergenic
1067852461 10:49762354-49762376 TCTCAGGGGCGCGCGCCCGTGGG - Intronic
1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG + Intergenic
1077368363 11:2170399-2170421 AGCCAGGAGCGGGCGCCTGCGGG - Intronic
1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG + Intronic
1090269259 11:125374444-125374466 AGTCAGGGGGGTGATCCTGCTGG + Intronic
1090959944 11:131547184-131547206 AGTCAGAGGCGTGAGCACACAGG + Intronic
1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG + Intronic
1096787764 12:54027380-54027402 AGGCAGGGGCTTGAGCCTGCAGG + Intronic
1103595392 12:122022050-122022072 AGGCTGGGGAGCGCGCCCGCCGG - Exonic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1128374244 15:67064560-67064582 ATTCAGGGGCGTCTGCCCGCAGG - Intronic
1129221599 15:74134638-74134660 GGTCAGGGGCCTGAGGCCGCAGG - Exonic
1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG + Intronic
1132180527 15:99749465-99749487 AGTCATGGCCGTGTGCCCGTGGG - Intergenic
1132464854 16:72637-72659 AGCGAGGGGCGTGCGCCCGGGGG + Intronic
1132796317 16:1725039-1725061 AGGCAGGAGGGTGGGCCCGCTGG + Intronic
1133046290 16:3090062-3090084 GGTCCTGGGCGTGCGCCAGCAGG + Exonic
1137655362 16:50153971-50153993 AGCCCGGGGCCTGGGCCCGCCGG + Exonic
1144684386 17:17216363-17216385 CCTCAGGTGCGTGCCCCCGCGGG - Exonic
1158579667 18:58671049-58671071 AGTCAGGGGAGAGCGCTCGCCGG + Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG + Exonic
1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG + Intronic
1163358352 19:16829586-16829608 GGTGAGGGGCGCCCGCCCGCGGG - Intronic
940199956 2:151139883-151139905 AGTGAGGGCCGTGAGCCTGCGGG - Intergenic
1175862109 20:62156132-62156154 AGTCAGTGGCTTGCGCCCCCCGG + Intronic
1181645719 22:24231046-24231068 TGTCAGGGGCGTGCACCTGGGGG - Intronic
1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG + Intronic
953027398 3:39153109-39153131 CGACGGGGGCGTGCGTCCGCGGG - Intronic
956787577 3:72655322-72655344 ATTCAGGTGTGTGCGACCGCAGG - Intergenic
967293933 3:187947553-187947575 AGTCAGGGGCGTGGCCCAGAAGG + Intergenic
968977145 4:3827891-3827913 AGTCAGGGGCCTGGGCTCCCTGG - Intergenic
982712186 4:158768885-158768907 AGCCCGGGGCGGGCGGCCGCCGG + Intergenic
1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG + Intergenic
1005913001 6:30327023-30327045 AGCCTGGGGCCTGCGCTCGCCGG + Intronic
1006717867 6:36131446-36131468 AGTCAGGGGCAGGCGCAGGCGGG + Intronic
1014215693 6:118750749-118750771 AGTCAGTGGCGTGCAGCAGCTGG + Intergenic
1015554960 6:134451734-134451756 AGGCAGGGGCCTGGGCCTGCAGG - Intergenic
1017021527 6:150143580-150143602 AGTCAGGGACATGCGCGCCCCGG - Intronic
1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG + Intergenic
1023111416 7:36815147-36815169 TGTCAGGAGCGTGAGCCCTCAGG + Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1031088276 7:117324071-117324093 AGAGAGGGGCTTGGGCCCGCGGG + Intergenic
1034347622 7:150397108-150397130 GGTCCCGGGCGTGCGCGCGCTGG - Exonic
1034676236 7:152894567-152894589 AGTGGGGGGCGCGCGCCCTCTGG - Intergenic
1036453957 8:8892533-8892555 AGTCAGGCAGGTGCGCCAGCCGG + Exonic
1037605112 8:20431715-20431737 AGTCAGGGGCCTGATCCTGCAGG - Intergenic
1040017431 8:42711057-42711079 AGTCAGGGGAGTGTGCCCAAAGG + Intronic
1051730701 9:20139894-20139916 GGTCAGGGGCCTGGGCCTGCTGG - Intergenic
1053010260 9:34628900-34628922 AGGCAGGTGAGTGCGGCCGCGGG - Intergenic
1190246899 X:48696816-48696838 AGGCAGAGGCGCGGGCCCGCTGG + Intronic