ID: 1112415508

View in Genome Browser
Species Human (GRCh38)
Location 13:99200746-99200768
Sequence GCCCCTGACTGCGCATGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 285}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415506_1112415508 -9 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415502_1112415508 14 Left 1112415502 13:99200709-99200731 CCCGGCAGGAAGGAGGGCGCTGA 0: 1
1: 0
2: 0
3: 30
4: 325
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415501_1112415508 15 Left 1112415501 13:99200708-99200730 CCCCGGCAGGAAGGAGGGCGCTG 0: 1
1: 1
2: 1
3: 23
4: 265
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415503_1112415508 13 Left 1112415503 13:99200710-99200732 CCGGCAGGAAGGAGGGCGCTGAC 0: 1
1: 0
2: 2
3: 22
4: 228
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415500_1112415508 19 Left 1112415500 13:99200704-99200726 CCTTCCCCGGCAGGAAGGAGGGC 0: 1
1: 0
2: 1
3: 27
4: 325
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415507_1112415508 -10 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285
1112415498_1112415508 20 Left 1112415498 13:99200703-99200725 CCCTTCCCCGGCAGGAAGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 250
Right 1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415508 Original CRISPR GCCCCTGACTGCGCATGCGC CGG Intergenic
900000201 1:10640-10662 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000206 1:10669-10691 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000211 1:10698-10720 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000216 1:10727-10749 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900000221 1:10756-10778 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019903 1:181149-181171 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019908 1:181178-181200 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019913 1:181207-181229 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019918 1:181236-181258 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019925 1:181265-181287 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900019930 1:181294-181316 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
900031819 1:378160-378182 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
900052367 1:606351-606373 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
901614821 1:10530420-10530442 GCCCCGGCCTGCGCCTCCGCCGG + Intronic
902680729 1:18042171-18042193 GCCCCTGCCTCCGCCTGCACAGG - Intergenic
903327815 1:22581323-22581345 GACCCTGAGTGCGTATGCACCGG - Intronic
906228650 1:44141493-44141515 GCCTCTGACTGCCCATGCTGAGG - Intergenic
924957675 1:248944946-248944968 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957680 1:248944975-248944997 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
924957685 1:248945004-248945026 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1067625668 10:47922701-47922723 GCCCCTGCCTCTGCAGGCGCCGG - Intergenic
1074372062 10:112908293-112908315 GCCTCTGACTTCTCATGCGTGGG + Intergenic
1075827380 10:125370804-125370826 GCCTCTGGGCGCGCATGCGCCGG - Intergenic
1076250952 10:128983381-128983403 GCCCCTGCCTGGGGATGGGCTGG + Intergenic
1076316574 10:129546224-129546246 GCCCCTGTCTGCCCCTGAGCTGG - Intronic
1076788255 10:132762159-132762181 GACCCTCACTGCGCAAGCGCTGG - Intronic
1076948093 10:133665350-133665372 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076949083 10:133668660-133668682 GCCGCCTACTGCGCACGCGCGGG + Intronic
1076950067 10:133671959-133671981 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076951051 10:133675258-133675280 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076952041 10:133678568-133678590 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076953030 10:133681878-133681900 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076954014 10:133685177-133685199 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076954998 10:133741529-133741551 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076955987 10:133744839-133744861 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076956977 10:133748149-133748171 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076957964 10:133751458-133751480 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076958949 10:133754757-133754779 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076959938 10:133758067-133758089 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076960922 10:133761366-133761388 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1076963519 10:133786460-133786482 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963526 10:133786489-133786511 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1076963533 10:133786518-133786540 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1077333695 11:1994253-1994275 GCCCCTCGCTGTGCAGGCGCTGG - Intergenic
1077363986 11:2154202-2154224 CCCCCTGGCTGGGCATGGGCTGG - Intronic
1091300380 11:134503470-134503492 GCCCCGGACAGCGCATCCTCCGG - Intergenic
1091372954 11:135076179-135076201 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372959 11:135076208-135076230 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372964 11:135076237-135076259 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372969 11:135076266-135076288 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372974 11:135076295-135076317 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372979 11:135076324-135076346 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1091372984 11:135076353-135076375 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1202816676 11_KI270721v1_random:49435-49457 GCCCCTCGCTGTGCAGGCGCTGG - Intergenic
1091373280 12:10736-10758 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373285 12:10765-10787 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373290 12:10794-10816 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373295 12:10823-10845 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373300 12:10852-10874 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373305 12:10881-10903 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1091373310 12:10910-10932 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1094126141 12:27023730-27023752 GCCCATGACTGCGCATCCTCTGG - Intronic
1094839274 12:34336198-34336220 CCCCCATGCTGCGCATGCGCGGG + Intergenic
1094842368 12:34347490-34347512 GCCCCCTGCTGCCCATGCGCGGG - Intergenic
1094870909 12:34598824-34598846 GCCCCCAACTGTTCATGCGCGGG + Intergenic
1094871548 12:34601820-34601842 GCCCCCAACTGCTCATGTGCGGG + Intergenic
1096615960 12:52833834-52833856 GCTCCTGAGTGCGCACTCGCTGG + Exonic
1102002855 12:109568557-109568579 GGCCCTGCCTGTGCCTGCGCTGG - Intronic
1105890536 13:24679881-24679903 GCCCCAGGCTGCGGGTGCGCAGG - Intergenic
1111333561 13:86792366-86792388 GCCCCTCACTGCGCGGGCACCGG - Intergenic
1111822256 13:93228059-93228081 GCCCCTGCCGGCGCAAGGGCGGG - Intronic
1112054328 13:95676838-95676860 GCCGCCGAGTCCGCATGCGCAGG - Intergenic
1112415508 13:99200746-99200768 GCCCCTGACTGCGCATGCGCCGG + Intergenic
1113693785 13:112330171-112330193 GCCCCTGACAGCGCATCCTGCGG + Intergenic
1113989949 13:114353281-114353303 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989954 13:114353310-114353332 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989959 13:114353339-114353361 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989964 13:114353368-114353390 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113989969 13:114353397-114353419 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1113990571 14:16024419-16024441 GCCGTCTACTGCGCATGCGCAGG - Intergenic
1116997352 14:51337584-51337606 GGCCCTGCCTGGGCATGTGCTGG - Intergenic
1121634495 14:95444726-95444748 GCGCCTGAATGAGCATGAGCTGG - Intronic
1202852820 14_GL000225v1_random:31570-31592 GCTCCCTACTGCGCACGCGCGGG + Intergenic
1202854976 14_GL000225v1_random:44307-44329 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1202857397 14_GL000225v1_random:59595-59617 GCCGCCAACTGCGCATGCACGGG + Intergenic
1202857960 14_GL000225v1_random:63413-63435 GACGCCTACTGCGCATGCGCGGG - Intergenic
1202864015 14_GL000225v1_random:104049-104071 GCCACCTACTGCGCACGCGCGGG - Intergenic
1202922218 14_KI270723v1_random:36173-36195 GCCGCCTACTGCGCACGCGCGGG + Intergenic
1123439908 15:20282672-20282694 GCGCCTCTCTGCGCCTGCGCTGG + Intergenic
1129950065 15:79578165-79578187 GCCCCAGACTGTGCATGAGTGGG + Intergenic
1132453287 15:101980190-101980212 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1132453292 15:101980219-101980241 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1133998753 16:10766551-10766573 GCCCCTGAGTGCACGTTCGCTGG - Intronic
1142043874 16:87912880-87912902 GCCCCTGACAGTGCCTTCGCCGG - Intronic
1143174614 17:4948983-4949005 GCCCGCGCCTGCGCCTGCGCCGG + Exonic
1143462052 17:7110064-7110086 GCCCCTGACTGAGCCTCCCCAGG - Intronic
1144840623 17:18183721-18183743 GTTCCTGTCTGCGCTTGCGCCGG + Intronic
1147429603 17:40363307-40363329 GCCCCGCACTTCGCGTGCGCCGG - Exonic
1147675237 17:42200799-42200821 GCCACGGACTGTGCATCCGCTGG + Exonic
1148323542 17:46771225-46771247 GGCCCTGGCAGCGCAGGCGCGGG - Intronic
1152947838 17:83207554-83207576 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1152965751 18:112169-112191 GCCGCCTACTGCGCACGCGCGGG - Intergenic
1155130957 18:22933818-22933840 GCCGCAGTCGGCGCATGCGCGGG - Exonic
1156484581 18:37456731-37456753 GCCCCAGATTGAGCATCCGCAGG - Intronic
1160567686 18:79797697-79797719 GCCCCTGCCAGGGCGTGCGCTGG + Intergenic
1160653413 19:246530-246552 GCGCCTGCCTGCGCCGGCGCCGG - Intergenic
1160904557 19:1446186-1446208 GCCCCTCTCCGCGCAGGCGCAGG + Intergenic
1163547300 19:17947994-17948016 GTCGCTCACTGCGCCTGCGCGGG + Intergenic
1168343606 19:55640277-55640299 GGCGCTGGCTGCGCATGCGAAGG - Intronic
1168728654 19:58606914-58606936 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728660 19:58606944-58606966 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728668 19:58606974-58606996 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728676 19:58607004-58607026 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728683 19:58607034-58607056 ACCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728691 19:58607064-58607086 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728702 19:58607098-58607120 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728710 19:58607129-58607151 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728725 19:58607167-58607189 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
1168728733 19:58607198-58607220 CCCCCTCTCTGCGCCTGCGCCGG + Intergenic
924958320 2:10854-10876 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958325 2:10883-10905 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958330 2:10912-10934 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958335 2:10941-10963 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958340 2:10970-10992 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958345 2:10999-11021 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958350 2:11028-11050 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958355 2:11057-11079 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958360 2:11086-11108 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958365 2:11115-11137 GCGCCTCTCTGCGCCTGCGCGGG - Intergenic
924958370 2:11144-11166 GCGCCTGTGTGCGCCTGCGCGGG - Intergenic
924958375 2:11173-11195 GCGCCTGTGTGCGCCTGCGCGGG - Intergenic
924958380 2:11202-11224 GCGCCTGTGTGCGCCTGCGCGGG - Intergenic
924958385 2:11231-11253 GCGCCTGTGTGCGCCTGCGCGGG - Intergenic
924958390 2:11260-11282 GCGCCTGTGTGCGCCTGCGCGGG - Intergenic
926630211 2:15129015-15129037 GGCCCTGAGTGCCCATGGGCGGG + Intergenic
927357301 2:22187848-22187870 GGCCATGGATGCGCATGCGCAGG + Intergenic
932130037 2:69179011-69179033 GCCCCAGACTGGGAATGCCCAGG + Intronic
937078879 2:119126296-119126318 GCCCCTGACTGCTGCTGGGCTGG + Intergenic
937096730 2:119240555-119240577 GCTCCTGTCTGCTCTTGCGCAGG - Intronic
938498051 2:131813623-131813645 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
946692517 2:222319950-222319972 GCCCCGGACTGCGGAGACGCAGG - Intergenic
949088913 2:242182551-242182573 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088920 2:242182580-242182602 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088927 2:242182609-242182631 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088934 2:242182638-242182660 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088941 2:242182667-242182689 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088948 2:242182696-242182718 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088955 2:242182725-242182747 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949088962 2:242182754-242182776 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1168860290 20:1041414-1041436 GCCTCTGACTGCTGATGCTCAGG + Intergenic
1171771316 20:29325261-29325283 GCCGTCTACTGCGCATGCGCAGG + Intergenic
1174476949 20:50802349-50802371 GCCCCTGGCTCCTCATGCCCCGG - Intronic
1175199084 20:57265972-57265994 GCTCCTGGCTGCGGAGGCGCCGG + Exonic
1176072828 20:63235807-63235829 GCCGCTGACTGCACGTGGGCAGG - Intergenic
1176706230 21:10121407-10121429 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1178832700 21:36069964-36069986 GCCGCTGAGCGCGCAGGCGCAGG - Exonic
1179891897 21:44339394-44339416 GCCCCAGGCCGCGCATGAGCAGG - Intronic
1179984088 21:44911700-44911722 GCCCCTGGCTGTGGATGCGTGGG - Intronic
1180264137 21:46698833-46698855 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264142 21:46698862-46698884 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264147 21:46698891-46698913 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264152 21:46698920-46698942 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264162 21:46698978-46699000 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264167 21:46699007-46699029 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264172 21:46699036-46699058 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264177 21:46699065-46699087 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264182 21:46699094-46699116 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264187 21:46699123-46699145 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264192 21:46699152-46699174 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264197 21:46699181-46699203 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264202 21:46699210-46699232 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180264207 21:46699239-46699261 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180316699 22:11283107-11283129 GCCGTCTACTGCGCATGCGCAGG + Intergenic
1180338626 22:11600405-11600427 ACCGCCTACTGCGCATGCGCGGG - Intergenic
1185430375 22:50807214-50807236 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1185430380 22:50807243-50807265 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
949089489 3:11012-11034 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089494 3:11041-11063 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089499 3:11070-11092 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089504 3:11099-11121 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089509 3:11128-11150 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089514 3:11157-11179 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089519 3:11186-11208 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089524 3:11215-11237 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089529 3:11244-11266 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089534 3:11273-11295 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089539 3:11302-11324 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089544 3:11331-11353 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089549 3:11360-11382 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089554 3:11389-11411 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089564 3:11447-11469 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089569 3:11476-11498 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089574 3:11505-11527 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089579 3:11534-11556 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089584 3:11563-11585 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089589 3:11592-11614 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089594 3:11621-11643 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089599 3:11650-11672 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089604 3:11679-11701 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949089609 3:11708-11730 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
949260441 3:2098647-2098669 GCCGCGCACTGAGCATGCGCGGG + Intergenic
950542574 3:13621097-13621119 GCCCATGTCTGCGCATCCCCAGG + Intronic
954277867 3:49554351-49554373 GCCCTGGACAGCGCATGCGCGGG + Intergenic
954628605 3:52036224-52036246 GCCCCTGACGGTGCATCCCCAGG + Intergenic
964376253 3:156051876-156051898 GCCCCTCACTGCCCAGGGGCCGG - Intronic
966711965 3:182980584-182980606 GCCCCGCACTGCGCATGAGCGGG - Exonic
968506614 4:973870-973892 GCGCCTGTCTGCGCAGCCGCGGG - Intronic
969669358 4:8581209-8581231 GCCAATGACTTGGCATGCGCCGG - Exonic
973907621 4:55546890-55546912 GTCGCTGACGACGCATGCGCCGG - Intronic
974750124 4:66129048-66129070 GCACCTGACTTCGCAAGTGCTGG - Intergenic
985073546 4:186191457-186191479 GCCCCTGACCCCGCATCCGGAGG + Intergenic
985451549 4:190066156-190066178 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985452539 4:190069450-190069472 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985453525 4:190072747-190072769 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985454515 4:190076040-190076062 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985455503 4:190079333-190079355 GCCGCCTACTGCGCACGCGCGGG + Exonic
985456487 4:190082627-190082649 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985457475 4:190085927-190085949 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985458462 4:190089220-190089242 GCCGCCTACTGCGCACGCGCGGG + Intergenic
985459451 4:190092520-190092542 GCCGCCTACTGCGCACGCGCGGG + Intronic
985463702 4:190175289-190175311 GCCGCCTACTGCGCACGCGCGGG + Intronic
985466742 4:190203758-190203780 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466747 4:190203787-190203809 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466752 4:190203816-190203838 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466759 4:190203845-190203867 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466766 4:190203874-190203896 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466773 4:190203903-190203925 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466780 4:190203932-190203954 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985466787 4:190203961-190203983 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
985467607 5:12473-12495 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467612 5:12502-12524 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467617 5:12531-12553 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467622 5:12560-12582 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467627 5:12589-12611 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467632 5:12618-12640 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467637 5:12647-12669 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467642 5:12676-12698 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467647 5:12705-12727 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467652 5:12734-12756 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467657 5:12763-12785 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467662 5:12792-12814 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467667 5:12821-12843 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467671 5:12845-12867 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467675 5:12869-12891 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467679 5:12893-12915 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
985467683 5:12917-12939 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
996330202 5:122320114-122320136 GCCCTTGACTGCTCTTGCACTGG - Intronic
999283948 5:150382924-150382946 GCCCCTTCCTGCACATGCACAGG - Intronic
1001431737 5:171667664-171667686 ACCCCTGACTGAGGCTGCGCTGG + Intergenic
1002742001 5:181440708-181440730 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1007775873 6:44223978-44224000 GCCGCTGACTGCGCTGGCGGAGG + Intronic
1017927434 6:158922457-158922479 CCCCCTGCCTGCGCAGGCCCAGG + Intergenic
1019059257 6:169243343-169243365 GGCCCTGACTGCAACTGCGCAGG - Intronic
1019247138 6:170716446-170716468 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1019636401 7:2078355-2078377 GCCCCTCGCTGCGAATGGGCAGG + Intronic
1022873024 7:34499163-34499185 GCACCTGACTGCCCATGTTCAGG - Intergenic
1023848069 7:44134473-44134495 CCCCCTGACTGTGCATGAGCAGG - Intergenic
1030293036 7:107891157-107891179 TCCCCTCCCTGCGCATGCACAGG - Exonic
1034412364 7:150948057-150948079 CCCCCTGACTGCCCAAGCACTGG + Intronic
1035500999 8:91488-91510 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
1041609502 8:59828328-59828350 GACCCTGACTGCCCTTGCCCTGG - Intergenic
1045294533 8:100861850-100861872 GCCCCTGACTGAGCCAGCTCTGG - Intergenic
1047062132 8:121239236-121239258 GTCCCTGCCTGCCCAAGCGCTGG - Intergenic
1047248036 8:123161134-123161156 GCCTCAGCCTGCGCCTGCGCCGG + Intergenic
1048915563 8:139179675-139179697 TCCCCTTACTGTGCATGTGCCGG + Intergenic
1049275493 8:141718144-141718166 GCCCATGCCTGCCCATGGGCTGG - Intergenic
1049883037 9:10977-10999 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049883042 9:11006-11028 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1049944515 9:581021-581043 GCCCCTCACTGCCCAGGGGCCGG + Intronic
1051255155 9:15205567-15205589 GACCCTGACTGTGGATGTGCAGG - Intronic
1053643515 9:40108524-40108546 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1053762636 9:41356966-41356988 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1054324372 9:63705752-63705774 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054541237 9:66268080-66268102 GCGCCTCTCTGCGCCTGCGCCGG - Intergenic
1059484551 9:114616856-114616878 GCCCCTGGCTGTGCCTGAGCTGG + Intronic
1061725470 9:132580056-132580078 GCCCCTGGCCAAGCATGCGCGGG - Intergenic
1061806390 9:133139810-133139832 GCCCCTGGCACCGCATGGGCAGG - Intronic
1062479205 9:136743684-136743706 GCCCCTGACTCCCCAGGCTCAGG - Intergenic
1202791266 9_KI270719v1_random:91496-91518 GCGCCTCTCTGCGCCTGCGCAGG + Intergenic
1203607913 Un_KI270748v1:71924-71946 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1192216740 X:69164628-69164650 GCGTGTGCCTGCGCATGCGCGGG + Intronic
1200402759 X:156029135-156029157 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402764 X:156029164-156029186 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402769 X:156029193-156029215 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402774 X:156029222-156029244 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402779 X:156029251-156029273 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402784 X:156029280-156029302 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402789 X:156029309-156029331 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1200402794 X:156029338-156029360 GCGCCTCTCTGCGCCTGCGCCGG + Intergenic
1201175987 Y:11308416-11308438 GCCACAGACTGTGCACGCGCCGG + Intergenic
1201177240 Y:11316425-11316447 GCCACCCACTGCGCACGCGCAGG + Intergenic
1201575321 Y:15456172-15456194 GGCCCTGAGTGCGCGTGCGCGGG - Intergenic