ID: 1112415509

View in Genome Browser
Species Human (GRCh38)
Location 13:99200747-99200769
Sequence CCCGGCGCATGCGCAGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415509_1112415517 10 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415509_1112415515 2 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415509_1112415518 16 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415509_1112415514 -5 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415509 Original CRISPR CCCGGCGCATGCGCAGTCAG GGG (reversed) Intergenic
924562260 1:245166628-245166650 CACATCGCATGCGCAGTCACTGG - Intronic
1070284337 10:75072398-75072420 CCCGTCGCATGCCCTGTGAGAGG + Intergenic
1072021683 10:91409728-91409750 CCCGGAGCTTGCGCAGCCCGGGG - Intergenic
1074701176 10:116093911-116093933 CACGGTGCATCCGCCGTCAGAGG - Intronic
1075827379 10:125370803-125370825 ACCGGCGCATGCGCGCCCAGAGG + Intergenic
1076625448 10:131818967-131818989 CCAGGTGCATCCGCAGTCTGGGG - Intergenic
1079335611 11:19567895-19567917 CCTGCCTCATGCCCAGTCAGGGG + Intronic
1084352111 11:68609764-68609786 CCCTGCGCATGCTCAGTCCCAGG + Intronic
1090799709 11:130162644-130162666 CCTGGCACAGGCTCAGTCAGTGG - Intronic
1091300379 11:134503469-134503491 CCCGGAGGATGCGCTGTCCGGGG + Intergenic
1094839275 12:34336199-34336221 CCCCGCGCATGCGCAGCATGGGG - Intergenic
1097173084 12:57128345-57128367 ATCGGCGCATGCGCACTCACTGG + Intronic
1100365009 12:93912347-93912369 CCTGGCACATGCTCAGTCAATGG + Intergenic
1112415509 13:99200747-99200769 CCCGGCGCATGCGCAGTCAGGGG - Intergenic
1122987599 14:105219718-105219740 CACAGCGCATGTGGAGTCAGTGG + Intronic
1124603090 15:31150884-31150906 CCTGACACATGCGCAGTAAGGGG + Intronic
1130062643 15:80580847-80580869 CCTGGCGCAGGGGCAGCCAGAGG - Intronic
1132476104 16:138728-138750 GCAGGCGCAGGCGCAGGCAGCGG + Intronic
1132691761 16:1184725-1184747 CCCGGCACATGGGCAGGCATAGG - Intronic
1143174615 17:4948984-4949006 CCCGGCGCAGGCGCAGGCGCGGG - Exonic
1143905502 17:10205836-10205858 CCTGACACATGCGCAGTAAGAGG + Intergenic
1153886846 18:9475207-9475229 GCAGGCGCCTGCGCAGTCGGTGG - Intronic
1155130956 18:22933817-22933839 CCCCGCGCATGCGCCGACTGCGG + Exonic
1156507720 18:37609072-37609094 CCCTGCGCATGCCCAGCCTGAGG - Intergenic
1160731096 19:642176-642198 CCCGGCCCACGCACAGTCACTGG - Intronic
1160773623 19:844526-844548 CCGGGCGGAGGCGCAGGCAGGGG - Intronic
1168728661 19:58606945-58606967 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728669 19:58606975-58606997 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728677 19:58607005-58607027 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728684 19:58607035-58607057 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728692 19:58607065-58607087 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728703 19:58607099-58607121 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728711 19:58607130-58607152 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728726 19:58607168-58607190 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
1168728734 19:58607199-58607221 GCCGGCGCAGGCGCAGAGAGGGG - Intergenic
926684855 2:15690768-15690790 CTCTGCGCCTGCGCAGTGAGGGG + Intronic
930113054 2:47695440-47695462 CCTGACACATGCGCAGTAAGGGG - Intergenic
1171504711 20:25623984-25624006 CCTTGCGCATGCGCAGGCGGCGG - Exonic
1174677295 20:52370712-52370734 CCCGGTGCATGCAAAGACAGAGG - Intergenic
1180338625 22:11600404-11600426 ACCCGCGCATGCGCAGTAGGCGG + Intergenic
1180999870 22:19983082-19983104 CCAGGCACCTGTGCAGTCAGAGG - Intronic
1185384553 22:50525892-50525914 CCCGGTGCACGCGGAGCCAGGGG + Exonic
950420977 3:12899344-12899366 CCCGGCGCCTGCCCAGGCGGAGG - Exonic
969669357 4:8581208-8581230 CCCGGCGCATGCCAAGTCATTGG + Exonic
973893058 4:55387109-55387131 CCTGACACATGCGCAGTAAGGGG + Intergenic
979041503 4:115803179-115803201 GCGCGCGCATGCGCACTCAGTGG + Intergenic
981784968 4:148466958-148466980 CCCGGCGCTTTCGGAGGCAGAGG + Intergenic
985569704 5:638349-638371 ACTGGCGCAGGCCCAGTCAGAGG + Intronic
1001431738 5:171667665-171667687 CCCAGCGCAGCCTCAGTCAGGGG - Intergenic
1006027760 6:31158234-31158256 CCTTGCGCAGGCGCGGTCAGGGG - Intronic
1007775874 6:44223979-44224001 CCCTCCGCCAGCGCAGTCAGCGG - Intronic
1021134970 7:16954469-16954491 CCTGGCTCATACGCAGTCTGTGG + Intergenic
1023848068 7:44134472-44134494 GCCTGCTCATGCACAGTCAGGGG + Intergenic
1028084263 7:86617126-86617148 CCAGGCACATGAGCTGTCAGTGG - Intergenic
1028997541 7:97117686-97117708 CTCTGCGCAGGCGCAGTCGGCGG + Exonic
1038489267 8:27958208-27958230 CCCGGCTCAGGCGTGGTCAGAGG + Intronic
1047248037 8:123161135-123161157 CCCGGCGCAGGCGCAGGCTGAGG - Intergenic
1048915564 8:139179676-139179698 CCCGGCACATGCACAGTAAGGGG - Intergenic
1056896799 9:90559028-90559050 CCCGGACCATGCCCAGTTAGGGG - Intergenic
1060319004 9:122538022-122538044 CCCGACACATGCACAGTAAGAGG - Intergenic
1186734606 X:12448096-12448118 CCCTGAACATGCACAGTCAGAGG - Intronic
1196410828 X:115416690-115416712 CCCTGCCCATGCACAGTTAGAGG + Intergenic
1198533372 X:137565930-137565952 CCCGGCGGCTGCCCAATCAGCGG + Intergenic
1201175988 Y:11308417-11308439 ACCGGCGCGTGCACAGTCTGTGG - Intergenic