ID: 1112415511

View in Genome Browser
Species Human (GRCh38)
Location 13:99200748-99200770
Sequence ACCCGGCGCATGCGCAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415511_1112415518 15 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415511_1112415517 9 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415511_1112415515 1 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415511_1112415514 -6 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415511 Original CRISPR ACCCGGCGCATGCGCAGTCA GGG (reversed) Intergenic
910029335 1:82698190-82698212 ACCTGTCGAGTGCGCAGTCATGG - Intergenic
1065215175 10:23440567-23440589 ACCCGGCCCATGCCCCGTCTTGG - Exonic
1076788253 10:132762157-132762179 GCCCAGCGCTTGCGCAGTGAGGG + Intronic
1089198194 11:116707592-116707614 ACCTGGCGCGAGCGCTGTCACGG - Intergenic
1094126139 12:27023728-27023750 AGCCAGAGGATGCGCAGTCATGG + Intronic
1094839277 12:34336200-34336222 ACCCCGCGCATGCGCAGCATGGG - Intergenic
1094841975 12:34346006-34346028 ACCCCGCGCATGCGCGGTAGGGG + Intergenic
1095942327 12:47735344-47735366 ACCCCACGCTTGGGCAGTCAGGG + Intronic
1112415511 13:99200748-99200770 ACCCGGCGCATGCGCAGTCAGGG - Intergenic
1118299955 14:64606406-64606428 ACCCAGAGCATGGGGAGTCATGG + Intergenic
1143174617 17:4948985-4949007 CCCCGGCGCAGGCGCAGGCGCGG - Exonic
1160559753 18:79748830-79748852 ACACGGCTCATGTGCAGTCACGG - Intronic
1160773625 19:844527-844549 ACCGGGCGGAGGCGCAGGCAGGG - Intronic
1160847155 19:1171673-1171695 ACCCGGCTCCAGCGGAGTCACGG - Intronic
1160980902 19:1816177-1816199 ACCCGGCCCCTGCGCAGGGACGG + Intronic
1166351467 19:42200508-42200530 ACCCTGCGCATCCGCAGTGCTGG - Intronic
928155225 2:28870399-28870421 CCCCGACGCAGGCGCAGTCGCGG - Intergenic
1172163398 20:32884236-32884258 ACCCGGCCCAGGCTCAGTAAAGG - Intronic
1172516181 20:35535550-35535572 AGCCAGCGCATGCGCAGCCTAGG - Intergenic
1173617278 20:44411373-44411395 GCCCGGCGCGAGCTCAGTCACGG - Intronic
1175675829 20:60945856-60945878 AGCCGGCTCATGGGCAGCCATGG - Intergenic
1040907477 8:52483543-52483565 ACCCCTCACATGCGCAGTTAGGG + Intergenic
1048915566 8:139179677-139179699 CCCCGGCACATGCACAGTAAGGG - Intergenic
1050394907 9:5185661-5185683 GCCTGGCGCAGGCGCAGACAGGG - Exonic
1200684414 Y:6246260-6246282 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1200989938 Y:9337501-9337523 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1200992607 Y:9357834-9357856 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1200995260 Y:9378113-9378135 GCCCGGCGCATGCGCCCTGAGGG + Intronic
1200997924 Y:9398458-9398480 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1201000433 Y:9466992-9467014 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1201003095 Y:9487304-9487326 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1201005754 Y:9507587-9507609 GCCCGGCGCATGCGCCCTGAGGG + Intergenic
1201008414 Y:9527917-9527939 GCCCGGCGCATGCGCCCTGAGGG + Exonic
1201575319 Y:15456170-15456192 TCCCCGCGCACGCGCACTCAGGG + Intergenic