ID: 1112415512

View in Genome Browser
Species Human (GRCh38)
Location 13:99200749-99200771
Sequence CACCCGGCGCATGCGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415512_1112415515 0 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415512_1112415518 14 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415512_1112415514 -7 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415512_1112415517 8 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415512 Original CRISPR CACCCGGCGCATGCGCAGTC AGG (reversed) Intergenic
901755889 1:11441277-11441299 CACCCGGGGCATGCTCCTTCAGG - Intergenic
904684703 1:32251624-32251646 CACCAGGCACATGGACAGTCAGG + Intronic
907316483 1:53575861-53575883 CACAGGGCACATGCACAGTCAGG + Intronic
913077453 1:115353090-115353112 GACCCTGAGCATGTGCAGTCTGG - Intergenic
1081700056 11:45147035-45147057 CACCCCGCGCCGGCGCCGTCCGG - Intronic
1083473480 11:62900298-62900320 GACCCGACACATGGGCAGTCAGG - Intergenic
1083895185 11:65616237-65616259 CCCCCGGCCCATGCCCCGTCTGG - Exonic
1094839278 12:34336201-34336223 GACCCCGCGCATGCGCAGCATGG - Intergenic
1094841974 12:34346005-34346027 GACCCCGCGCATGCGCGGTAGGG + Intergenic
1094850282 12:34379318-34379340 GGCCCTGCGCATGCGCAGTGGGG + Intergenic
1094852509 12:34388589-34388611 CGCCCAGCGCATGCACAGTGGGG + Intergenic
1094870553 12:34597055-34597077 CACCCTGCACATGTGCAGTTGGG - Intergenic
1095942326 12:47735343-47735365 CACCCCACGCTTGGGCAGTCAGG + Intronic
1103661939 12:122527117-122527139 CACCCCCGGAATGCGCAGTCGGG + Intergenic
1112415512 13:99200749-99200771 CACCCGGCGCATGCGCAGTCAGG - Intergenic
1114263795 14:21058988-21059010 CACCCTGAGCAGGCACAGTCTGG + Intronic
1122883767 14:104701517-104701539 CTCCAGGCGCTTGCGCAGGCCGG - Exonic
1141882627 16:86869804-86869826 CACGGGGCGCAGGCGCAGTTTGG + Intergenic
1142033589 16:87850499-87850521 CACCCGGCGGATGCACGCTCTGG - Intronic
1146167471 17:30600934-30600956 CACCCGGCGGCTGCCCAGCCCGG - Intergenic
1146219873 17:31008822-31008844 CACCCGGCGGCTGCCCAGCCCGG - Intergenic
1148848429 17:50542176-50542198 CGTCCGGCGCAGGCGCAGGCCGG - Exonic
1151329416 17:73398167-73398189 CACCTGGCGCATGCGGAAGCTGG + Exonic
1151349313 17:73522323-73522345 CACCAGGCACATGAGCAGCCAGG - Intronic
1160773626 19:844528-844550 CACCGGGCGGAGGCGCAGGCAGG - Intronic
1163612928 19:18310360-18310382 CACCCAGCGCAGGCCCTGTCAGG - Intronic
1163634448 19:18431685-18431707 CACCCTGCGGATGCCGAGTCAGG + Exonic
1167371497 19:49085388-49085410 CGCACGGCGCGTGCGCAGTGAGG + Intergenic
1168381387 19:55926696-55926718 CACCCTCCGCATGGGCAGTGAGG - Intronic
932474023 2:71989849-71989871 TGCCTGGCGCATGCGCATTCCGG - Intergenic
938097572 2:128473699-128473721 CACACCGCCCATGCTCAGTCAGG + Intergenic
947920667 2:233868419-233868441 CCGACGGCGCATGCGCGGTCCGG + Intergenic
948563373 2:238868297-238868319 CTCCCGGCACTTGGGCAGTCAGG - Intronic
1175575223 20:60055929-60055951 CACCCGGCCCAGGCTCAGGCAGG - Exonic
1175790620 20:61737977-61737999 CACCCGCTGCATGCGCTGTGGGG - Intronic
1176274411 20:64255681-64255703 CCCGCGGCGCATGCGCAGTCAGG + Intronic
1176933570 21:14841989-14842011 CACCTGGCGCATGAGCACGCTGG - Intergenic
1178996378 21:37404441-37404463 CACCTGGCCCATGTGCATTCTGG + Intronic
1181265825 22:21629988-21630010 CACCAGGCGCATGCGAGGGCGGG + Exonic
950759251 3:15206208-15206230 CGCCCGACGCAGGCGCAGCCTGG - Intronic
969418470 4:7076119-7076141 CACACAGCGCAGGAGCAGTCAGG - Intergenic
976184114 4:82428989-82429011 CACGCGGCGCCTGCGCGCTCGGG + Intronic
983649998 4:170027594-170027616 TGCCCGGAGCATGCTCAGTCGGG - Intronic
988529889 5:32018182-32018204 CATCCGGCTCATGTGCACTCTGG + Intronic
1001683954 5:173578526-173578548 CACCCTGCCCATGGGAAGTCAGG - Intergenic
1019148061 6:169987211-169987233 CACCTGGGGGATGGGCAGTCGGG + Intergenic
1032474465 7:132202755-132202777 CACCAGCCACATGCGAAGTCTGG + Exonic
1033400146 7:141015092-141015114 TACCTGGCGCCTGCGCAGTAAGG + Intronic
1047024720 8:120812415-120812437 CACCCGGCGAAGGTGCAGTGTGG - Intronic
1047787617 8:128168934-128168956 CACTCAGTGCATGCCCAGTCTGG - Intergenic
1049883034 9:10974-10996 CCCCCGGCGCAGGCGCAGAGAGG + Intergenic
1061248577 9:129413905-129413927 CAACCCGCGCATGCGCAGCGGGG + Intergenic
1061853716 9:133429997-133430019 CACCCGCCGGATGCGCAGCCTGG + Exonic
1062056625 9:134472406-134472428 CACAGGGCTCATGCCCAGTCTGG - Intergenic
1201575318 Y:15456169-15456191 CTCCCCGCGCACGCGCACTCAGG + Intergenic