ID: 1112415514

View in Genome Browser
Species Human (GRCh38)
Location 13:99200765-99200787
Sequence CCGGGTGCGCCGTTCGTCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415507_1112415514 9 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415506_1112415514 10 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415512_1112415514 -7 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415511_1112415514 -6 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1112415509_1112415514 -5 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415514 Original CRISPR CCGGGTGCGCCGTTCGTCAG CGG Exonic
900783578 1:4633582-4633604 CCGGGTGCCCAGTGCGGCAGAGG + Intergenic
915313898 1:155017568-155017590 CCGGGGGCGGCGTGAGTCAGGGG - Exonic
920561148 1:206939351-206939373 CCGGGTGTGCCGGTTGACAGAGG + Exonic
1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG + Exonic
1113379093 13:109786697-109786719 CCGAGCGCGCCGTCCGTCGGGGG - Intergenic
1139575987 16:67842412-67842434 CCGGCTGCGCCGAGCGGCAGTGG + Exonic
1152238138 17:79149056-79149078 TAGAGTGCGCTGTTCGTCAGTGG - Intronic
1169799886 20:9504017-9504039 AGGGGGGCGCCGTTAGTCAGCGG - Intergenic
1001066303 5:168537649-168537671 CCGGGTGCGCCATTCCACGGGGG - Intergenic
1056992624 9:91424712-91424734 GCGGGTGCGGCGTTCCTCGGAGG + Intergenic
1196750243 X:119109461-119109483 CCTAGTGCGCCATTCCTCAGAGG - Intronic