ID: 1112415515

View in Genome Browser
Species Human (GRCh38)
Location 13:99200772-99200794
Sequence CGCCGTTCGTCAGCGGCGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 14}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415511_1112415515 1 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415512_1112415515 0 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415507_1112415515 16 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415506_1112415515 17 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14
1112415509_1112415515 2 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415515 Original CRISPR CGCCGTTCGTCAGCGGCGAG TGG Exonic
1067060649 10:43076536-43076558 CGCCATTTCTCAGAGGCGAGAGG - Intergenic
1105022993 12:132829350-132829372 AGCCGTTCCCCAGCGGCCAGCGG - Intronic
1112415515 13:99200772-99200794 CGCCGTTCGTCAGCGGCGAGTGG + Exonic
1112520332 13:100089148-100089170 CGCCGTCCGGCAGCGACCAGCGG - Exonic
1142811295 17:2396798-2396820 CTGCGTTCGTCAGCGGAGCGGGG - Intronic
1144258699 17:13496476-13496498 TGCTCTTCGTGAGCGGCGAGCGG - Exonic
1144345453 17:14345348-14345370 TGCTCTTCGTGAGCGGCGAGCGG + Exonic
1167369564 19:49072544-49072566 CGCCGTGCGGCTGCTGCGAGCGG - Exonic
1168696920 19:58408893-58408915 CGCCGTGCCCCACCGGCGAGTGG + Exonic
1169208208 20:3751716-3751738 CGCCATAGGTGAGCGGCGAGCGG - Exonic
1169799884 20:9504010-9504032 CGCCGTTAGTCAGCGGCTGGTGG - Intergenic
1176005919 20:62862070-62862092 CGCCGGGCCTCAGCGGGGAGTGG - Intergenic
1176206250 20:63889889-63889911 CTCCCTTCCTCAGCGGGGAGTGG + Exonic
1179643957 21:42764166-42764188 CGCCGTATGTCAGCGCCGAGTGG - Intronic
1183547398 22:38461815-38461837 CACCTGTCGCCAGCGGCGAGGGG + Intergenic
961359462 3:126357692-126357714 CGCCGCGAGACAGCGGCGAGAGG - Intergenic
966787623 3:183635685-183635707 CGCGGTCCCTCAGCGGCGGGCGG - Exonic
996765340 5:127030290-127030312 CGCGGTTCGGCGGCGGCGAGAGG - Intronic