ID: 1112415517

View in Genome Browser
Species Human (GRCh38)
Location 13:99200780-99200802
Sequence GTCAGCGGCGAGTGGCCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415513_1112415517 -8 Left 1112415513 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415511_1112415517 9 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415509_1112415517 10 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415507_1112415517 24 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415506_1112415517 25 Left 1112415506 13:99200732-99200754 CCCAGCGGGCGCACGCCCCTGAC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74
1112415512_1112415517 8 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG 0: 1
1: 0
2: 0
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415517 Original CRISPR GTCAGCGGCGAGTGGCCTCG CGG Exonic
900233335 1:1574185-1574207 GTCCGCGGCGAGGGGCTGCGCGG - Intronic
900363032 1:2299127-2299149 GTCAGCGCCGAGTGGCCAGCAGG + Intronic
900489825 1:2942308-2942330 GTCAGAGGTGAGAGGCCTCCAGG - Intergenic
901651564 1:10746095-10746117 GTCATCATAGAGTGGCCTCGAGG + Intronic
903462691 1:23530586-23530608 GTCCGTGGGGAGTGGCGTCGAGG + Exonic
905308637 1:37034941-37034963 GTCTGCGGAGCCTGGCCTCGCGG + Intergenic
908314339 1:62918064-62918086 GTGAGTGTGGAGTGGCCTCGGGG - Intergenic
913323454 1:117606347-117606369 GTCAGGGGCGGGGGTCCTCGAGG - Intronic
915730648 1:158051765-158051787 GTCAATGGCAAGTGGCCTGGTGG - Intronic
1075222739 10:120598998-120599020 GTCACCAGCGTGTGGCCTTGTGG + Exonic
1077115881 11:884467-884489 GTCAGTGGAGAGTGGCCAAGAGG + Intronic
1083607366 11:63986820-63986842 GACAGGGGCGAGAGGGCTCGGGG - Intronic
1089700275 11:120240291-120240313 GGCAGAGGCGAGGGGCCTGGGGG + Intronic
1090210992 11:124921083-124921105 GTCTGCGGCCAGTGGCCCGGGGG - Exonic
1090334219 11:125951875-125951897 CTGAGCTGCGAGTGGCCTGGCGG + Intergenic
1090636797 11:128694597-128694619 GTCAAGGGCGAGAGACCTCGGGG + Intronic
1091802701 12:3334492-3334514 GTCAGCGGTGAGAGGCCACTGGG - Intergenic
1093077833 12:14775168-14775190 GTCAGGGGAGGGTGGCCTGGAGG + Intronic
1098596169 12:72274195-72274217 GCCAGCGATAAGTGGCCTCGCGG + Intronic
1103722158 12:122980835-122980857 GTCCGCCGCGAGTGGCGTCTGGG - Exonic
1104719827 12:131039130-131039152 CTCAGCGGGCAGTGGCCTGGAGG - Intronic
1112415517 13:99200780-99200802 GTCAGCGGCGAGTGGCCTCGCGG + Exonic
1113848085 13:113403716-113403738 GTCAGGGGGCAGTGGCCTGGGGG - Intergenic
1118776963 14:68979233-68979255 GACAGCGGCGGCTGGGCTCGCGG + Exonic
1124588801 15:31035504-31035526 GTCAGCGGTTAGTGGGCTGGGGG + Intronic
1126236399 15:46390313-46390335 GTTAGCAGCTACTGGCCTCGAGG - Intergenic
1127628682 15:60805178-60805200 GTCAGAGGAGAGTGGCGTCATGG - Intronic
1134300098 16:12983233-12983255 GGCAGCGGGGAGTGGCTTGGAGG + Intronic
1134860815 16:17558794-17558816 GTCAGCTCTGAGTGGCCTTGCGG + Intergenic
1136408761 16:30064729-30064751 GTCAGCAGCGAGTGAGCTAGGGG - Intronic
1138389322 16:56658627-56658649 GTGAGCGGCGAGTGACCTGCAGG - Intronic
1138865233 16:60810311-60810333 GTCAGAGGTGAGTTGCCTCAAGG - Intergenic
1142139863 16:88468077-88468099 GTCAGCGGCCGGTGGGCTCGCGG - Intronic
1142150543 16:88510721-88510743 GGCAGCGGCTGGTGGCCCCGTGG - Intronic
1142347107 16:89561012-89561034 GGCAGCGGCGCGTGGCCACGTGG + Exonic
1142866306 17:2793587-2793609 GTCAGCGGCGGGAGGCCAGGTGG + Intronic
1143211605 17:5191997-5192019 GCCAGCGCCGACTGGCGTCGTGG - Intergenic
1144708217 17:17383938-17383960 GGCAGCGGCGCGTGGCCACGTGG - Intergenic
1144729552 17:17518622-17518644 GTCAGCTGCTGGTGGCCTCTCGG + Intronic
1152606656 17:81294938-81294960 GCCCGGGGCGAGAGGCCTCGGGG + Exonic
1159058362 18:63489829-63489851 GTCAGCTGAAAGGGGCCTCGGGG - Intronic
1160592363 18:79951607-79951629 GTCAGCGGCGCGGGGACGCGGGG - Exonic
1160597766 18:79988817-79988839 GGCGGCGGCGGGCGGCCTCGGGG - Intronic
934856841 2:97734971-97734993 GTCAGGGGCCAGTGGACTCAGGG - Intronic
936531266 2:113278323-113278345 CTCAGCGGCGCGGGGGCTCGGGG + Intronic
940140210 2:150485417-150485439 CCCAGCGGGGAGTGGCCTCGTGG - Intronic
944668051 2:201972992-201973014 GTCAGTGGCAGGTGGCCTTGGGG - Intergenic
948662275 2:239514963-239514985 GGCAGCGGCGGGTGGCCACGGGG - Intergenic
949069483 2:242015623-242015645 GTAAGTGGCGTGTGGCCTCCTGG - Intergenic
1170900692 20:20460005-20460027 GGCAGAGGTGAGTGGCCTCAGGG - Intronic
1173832381 20:46099570-46099592 GGCAGCGGCGCGTGGCCACGTGG + Intergenic
1175521452 20:59604925-59604947 GTCACCGGCGAGGGGGCTGGAGG - Exonic
1176137725 20:63531778-63531800 GTCAGCGGCTTGCGGCCTGGTGG + Intronic
1176382067 21:6118541-6118563 GTCAGGGACAAGTGGCCTCTGGG - Intronic
1179206358 21:39283801-39283823 GTCATTGGCGACTGGCCTTGAGG - Intronic
1179741405 21:43419698-43419720 GTCAGGGACAAGTGGCCTCTGGG + Intronic
1184846547 22:47091169-47091191 GTTGGTGGGGAGTGGCCTCGCGG + Intronic
1185254652 22:49825672-49825694 GTCAGGGACGCCTGGCCTCGGGG + Intronic
950615995 3:14158602-14158624 GGGAGCGGCGGGTGGCCTCCAGG - Exonic
964749185 3:160039024-160039046 GTCAGCGGTTGGTCGCCTCGCGG - Intergenic
968107226 3:196009594-196009616 GTAAGTGGCGTGTGGCCTCCTGG + Intergenic
979158608 4:117429735-117429757 GTCAGCCCCGAGTGGTCTGGGGG - Intergenic
985705925 5:1401364-1401386 GTCAGCTGCAGGTGGCCCCGAGG - Intronic
988066611 5:26233239-26233261 GTAAGTGGCGTGTGGCCTCCTGG + Intergenic
995588611 5:113674812-113674834 TTCAGAGGTGAGTGGCCTCGTGG + Intergenic
1002616196 5:180458029-180458051 GACAGGGGCAAGTGGCCTTGGGG + Intergenic
1002641224 5:180631558-180631580 GTCAGGGCAGAGTGGCCTCGGGG - Intronic
1004285809 6:14319448-14319470 GTCAGTGGCCAGTGGCCACTTGG - Intergenic
1005748398 6:28861468-28861490 GGCAGCAGCGTGTGGCCACGTGG + Intergenic
1006435867 6:34025992-34026014 GTCAGCACCGGGTGGGCTCGGGG - Intronic
1007575600 6:42923490-42923512 CTCAGGGGAGAGTGGCCTCAGGG + Intronic
1007680321 6:43629151-43629173 GGCAGCGGCGGATGGACTCGCGG - Exonic
1029461053 7:100694087-100694109 GTAAGCGCCCAGTGGCCCCGCGG - Intergenic
1032020691 7:128405899-128405921 GGCAGCGGCGGGCGGCCGCGCGG - Intronic
1035544102 8:466253-466275 ACCAGAGGCGAGTGGCCTGGTGG + Intronic
1036699429 8:11002215-11002237 GTCAGAGGGGAGTGGCTTTGTGG - Intronic
1037783248 8:21885817-21885839 GTGAGCGGCGAGTGGACAGGAGG - Intergenic
1037823600 8:22147684-22147706 GGCAGGGGTGAGTGGCCCCGGGG + Exonic
1049368787 8:142253637-142253659 GTCAGGGCAGAGTGACCTCGAGG - Intronic
1057596315 9:96418423-96418445 GCCAGCGGGCAGCGGCCTCGCGG - Intergenic
1061588675 9:131584295-131584317 TTCAGAGGTGAGTGGCCTTGGGG - Exonic
1062393973 9:136345262-136345284 GTCAGCGTCGGGTGGCCATGGGG + Intronic
1200384329 X:155874692-155874714 TCCAGCGGGGAGTGGACTCGAGG - Intergenic