ID: 1112415518

View in Genome Browser
Species Human (GRCh38)
Location 13:99200786-99200808
Sequence GGCGAGTGGCCTCGCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112415509_1112415518 16 Left 1112415509 13:99200747-99200769 CCCCTGACTGCGCATGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415513_1112415518 -2 Left 1112415513 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415512_1112415518 14 Left 1112415512 13:99200749-99200771 CCTGACTGCGCATGCGCCGGGTG 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415511_1112415518 15 Left 1112415511 13:99200748-99200770 CCCTGACTGCGCATGCGCCGGGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114
1112415507_1112415518 30 Left 1112415507 13:99200733-99200755 CCAGCGGGCGCACGCCCCTGACT 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112415518 Original CRISPR GGCGAGTGGCCTCGCGGCGC CGG Exonic
900233332 1:1574179-1574201 GGCGAGGGGCTGCGCGGCGGCGG - Intronic
902771278 1:18646875-18646897 GGCGCGGGGCGGCGCGGCGCGGG + Intronic
919075585 1:192808976-192808998 GGGGCGGGGCCTCGCGGCTCCGG - Intergenic
922287592 1:224183448-224183470 CGTGCGTGGCCTCCCGGCGCCGG + Intronic
1063450201 10:6145566-6145588 GGAGAGGGGCAGCGCGGCGCGGG + Intronic
1063455363 10:6178827-6178849 GGAGAGTGGCCTGGCTGAGCCGG + Intronic
1067017609 10:42769768-42769790 GGGGCGTGGCCTCCTGGCGCGGG + Intergenic
1067560298 10:47300485-47300507 GGCGAGGGGCTTAGCGGAGCAGG - Exonic
1070162572 10:73874686-73874708 GGGGAGGGGCCTCCCGCCGCCGG + Intergenic
1070610095 10:77926884-77926906 GGCGAGTTTTCTCGCGGGGCGGG - Intergenic
1070810728 10:79296541-79296563 GGTGAGTGGCCTCGGGGGGTTGG - Exonic
1076908151 10:133373412-133373434 GCCGCCTGGTCTCGCGGCGCTGG - Exonic
1079090442 11:17476765-17476787 GGCCAGGGGCATGGCGGCGCGGG + Exonic
1081799330 11:45847309-45847331 GGCGATTGGCCCAGAGGCGCCGG - Intronic
1084062488 11:66685494-66685516 GGCGAGTGCCCTCGCATGGCAGG + Exonic
1084103884 11:66968009-66968031 GGCGAGTGGGCTCTCGGGACTGG + Intergenic
1085472951 11:76769651-76769673 GGGGAGGGGCCTCGGGGTGCAGG - Intergenic
1085739925 11:79069884-79069906 GGCGCTCGGCGTCGCGGCGCCGG + Exonic
1085781686 11:79414971-79414993 GGGGAGAGGCCTCGTGGTGCAGG + Intronic
1089180578 11:116580515-116580537 GGCTCGTGGCCTCCGGGCGCAGG - Intergenic
1096647658 12:53047373-53047395 GGTGAGTGGCCGCGCCGCGCTGG + Intronic
1103953987 12:124566765-124566787 GGCGTGGGGCCACGGGGCGCTGG - Intronic
1104961581 12:132490624-132490646 CGCGGGCGGCCTCCCGGCGCCGG - Exonic
1109037667 13:57286597-57286619 GGAGTGCGGGCTCGCGGCGCGGG - Intergenic
1112415518 13:99200786-99200808 GGCGAGTGGCCTCGCGGCGCCGG + Exonic
1115851749 14:37595019-37595041 GACGGGCGGCCGCGCGGCGCGGG + Exonic
1122947767 14:105020998-105021020 GGCGGGCGGCCTCGCGGGTCAGG - Exonic
1122959396 14:105087576-105087598 GGCGGGCAGCCTCGCGGCGGCGG + Intergenic
1125300861 15:38252566-38252588 GGCTAGGGGCCCCGCGGCGGCGG - Exonic
1128087248 15:64894695-64894717 GGGGAGTGGCCGCGGGGCGTAGG + Intronic
1129446990 15:75625607-75625629 GCCGAGTTGCCTCTCGGTGCCGG - Exonic
1131383017 15:91980205-91980227 GGGGAGAGGCCTCGCTGCCCCGG + Intronic
1132314352 15:100879593-100879615 GGCGAGAGAGCGCGCGGCGCGGG + Exonic
1136365199 16:29806447-29806469 GGCGGGAGGCCCCGCGGGGCCGG - Intronic
1139433889 16:66925387-66925409 GGTGAGTGTCCTGGCGGAGCGGG - Exonic
1142338878 16:89508092-89508114 GGCGTGAGGCCCCTCGGCGCGGG + Intronic
1142851814 17:2708055-2708077 GGCCAGTGGCCGCACGGCGGGGG + Intronic
1143521541 17:7446971-7446993 GGCGCGGGGCCTCGGGGGGCGGG + Intronic
1143521549 17:7446988-7447010 GGCGGGGGGCCTCCGGGCGCGGG + Intronic
1143596241 17:7915964-7915986 GGCACGTGACCACGCGGCGCAGG + Intergenic
1143780412 17:9226043-9226065 GGCCTGTGGGCTCGGGGCGCCGG + Intronic
1144767005 17:17738378-17738400 GGCGGCTGGCCTGGCGGGGCGGG + Intronic
1147400763 17:40178742-40178764 GGCGGGTGGCATGGCTGCGCTGG - Intronic
1148397775 17:47323942-47323964 GGGGCGGGGCCGCGCGGCGCGGG + Intronic
1152616895 17:81342006-81342028 GGCCAGTGCGCACGCGGCGCCGG - Intergenic
1154382963 18:13869169-13869191 GGCGACTGGCCTCGGGGCTCTGG - Intergenic
1155054524 18:22171880-22171902 GCCGCGGGGCCTGGCGGCGCTGG + Exonic
1158453359 18:57586399-57586421 GGCGAGGGGCGTCGCGGAGAAGG - Intronic
1158505597 18:58044177-58044199 GGAGGGTACCCTCGCGGCGCCGG + Intergenic
1160852498 19:1199681-1199703 GGCGACTGGCCCCACGGTGCCGG + Intronic
1160987128 19:1844236-1844258 GGTGAGCAGCCTCCCGGCGCTGG + Intronic
1163529766 19:17842495-17842517 GGCAGGCGGCCACGCGGCGCAGG + Exonic
1163722965 19:18906938-18906960 GGTGAGTGGCCTCCCTGCTCTGG - Exonic
1166790390 19:45395691-45395713 GGCGCGGGGCCCCGCGGGGCTGG + Exonic
1168078448 19:53992814-53992836 GGCGAAGGGCCTCGAGGGGCGGG - Exonic
1168494879 19:56840057-56840079 TGCCATCGGCCTCGCGGCGCCGG - Intronic
1168641502 19:58034383-58034405 GGCTAGAGGCCACGCGGGGCGGG + Intronic
1168718985 19:58544636-58544658 GGCGCTCGGCCTCGCGGCGGCGG + Exonic
927905042 2:26849401-26849423 GGCGCGGGGCCCCGCGGCCCAGG + Intronic
932616201 2:73233180-73233202 GGCGAGAGGAAACGCGGCGCCGG - Exonic
932779108 2:74549066-74549088 TGGGAGTGGCCTCGCGAGGCCGG + Intronic
937459044 2:122069798-122069820 GGCGAATGGCCTGGCTGGGCTGG - Intergenic
938796020 2:134718859-134718881 GGCGCGTGGCCCCGGGGCGGCGG + Exonic
941095912 2:161239079-161239101 GGGGAGTGGGCGCGCGGCGCAGG - Intergenic
947641382 2:231709467-231709489 GGCGAGAGCCCACGCGCCGCAGG + Intronic
948662271 2:239514957-239514979 GGCGGGTGGCCACGGGGCGGGGG - Intergenic
1169137995 20:3209384-3209406 GGCGAGTGGGCTCGCGGTGGCGG - Exonic
1175846884 20:62064429-62064451 GGTGAGTGGCCGCACGGGGCGGG - Exonic
1176005625 20:62861051-62861073 GGCTCGGGGCCGCGCGGCGCGGG + Exonic
1176077261 20:63254199-63254221 GGCGTGGGGAGTCGCGGCGCCGG - Intronic
1176156978 20:63626906-63626928 AGCGAGAGGCCTCGCCGCGGGGG + Intronic
1178488461 21:33033235-33033257 CGCGGGTGGGCGCGCGGCGCGGG + Intergenic
1179529742 21:42010449-42010471 GGGGGGGGGCCTCGCGGCGCAGG + Intergenic
1181745467 22:24952733-24952755 GGCAGGTGGCGGCGCGGCGCGGG + Intronic
1182771807 22:32801777-32801799 GGCGGGCGGCCTCCCGGCGAAGG - Exonic
1183067260 22:35371867-35371889 GGCGGGTGGCATCGCGCCCCAGG - Intergenic
1184412216 22:44331843-44331865 GGCGGGCGGCCGGGCGGCGCGGG - Intergenic
1184663699 22:45976881-45976903 GCCGAGTGCCCGCGCGTCGCCGG - Exonic
1184846456 22:47090722-47090744 GGGGAGTGGCCTCGCAGAGGGGG + Intronic
1184846470 22:47090789-47090811 GGGGAGTGGCCTCGCGGAGGGGG + Intronic
1184846510 22:47090981-47091003 GGGGAGTGGCCTCGCAGAGGGGG + Intronic
1184846523 22:47091047-47091069 GGGGAGTGGCCTCGCAGAGGGGG + Intronic
1184846538 22:47091114-47091136 GGGGAGTGGCCTCGGGGAGGGGG + Intronic
1184846551 22:47091175-47091197 GGGGAGTGGCCTCGCGGAGGGGG + Intronic
1184846589 22:47091411-47091433 GGGGAGTGGCCTCGCGGAGGGGG + Intronic
1184846601 22:47091478-47091500 GGGGAGTGGCCTCGTGGAGGGGG + Intronic
959085635 3:101849131-101849153 GGGGAGAGGGCGCGCGGCGCAGG - Intronic
961305728 3:125958414-125958436 GGCGGGTGGCCTCCAAGCGCCGG - Intergenic
961812698 3:129531011-129531033 GGCGAGTGGGGGTGCGGCGCAGG - Exonic
962259719 3:133895095-133895117 GGCGGCTGGCTCCGCGGCGCTGG - Intronic
962816660 3:139006379-139006401 GGCGAAGGACCGCGCGGCGCGGG + Intronic
967055414 3:185825371-185825393 GGCGAGGGGCGCAGCGGCGCGGG - Intergenic
969315457 4:6378969-6378991 GGAGAGTGACCTCACGGCTCTGG - Intronic
969681094 4:8643979-8644001 GGGGGGTGGCCTCGCACCGCTGG + Intergenic
972543157 4:40056754-40056776 GGGGAGGGGTCTCGAGGCGCCGG - Intergenic
984785787 4:183566148-183566170 GGCGAGGGGCCTTGCGGCCAAGG + Intergenic
986330771 5:6714482-6714504 GGCGCGGGGCCGCGCGGCCCGGG - Intergenic
1002342445 5:178526037-178526059 GGCGAGTGTCCTCGGAGTGCTGG + Intronic
1005515494 6:26550583-26550605 GGGGCGGGGCGTCGCGGCGCTGG - Intergenic
1013641468 6:112087202-112087224 GGCGAGGGGGCTCGCGGCGGCGG + Intronic
1015314951 6:131807705-131807727 CCTGCGTGGCCTCGCGGCGCGGG - Intergenic
1016992792 6:149941651-149941673 AGCCAGGGACCTCGCGGCGCAGG + Intergenic
1019121840 6:169810439-169810461 GGGGAGTGGCCTCGGTGGGCAGG + Intergenic
1019121857 6:169810496-169810518 GGGGAGTGGCCTCGGTGGGCAGG + Intergenic
1020430089 7:8109841-8109863 GGGGAGTGGCCTCATGGCACAGG + Intergenic
1021313214 7:19117334-19117356 GACGCGTGGCCTCGCGGGCCCGG + Exonic
1023696934 7:42857200-42857222 GCCGAGTGGCCCCACGGCCCGGG - Intergenic
1024234773 7:47389710-47389732 AGAGAGTGGCCTGGGGGCGCCGG - Intronic
1031604269 7:123749159-123749181 GGCGGCGGGCCTCGCGGCGCGGG + Intergenic
1031966682 7:128032232-128032254 GGCGCGGGGCTGCGCGGCGCCGG - Intronic
1034469838 7:151249198-151249220 GGCGCGAGGCCTCGCGGGCCGGG - Intronic
1037337117 8:17801787-17801809 GCCGAGGGGCCTCGCACCGCGGG + Intergenic
1039979218 8:42392127-42392149 GGCAAGTGGCCTCCGGGCGCGGG + Intronic
1042722619 8:71842126-71842148 GGCGAGTGGCTTCTCTGGGCCGG - Exonic
1049665566 8:143841175-143841197 GGGGAGGGGCTTCGCGGAGCAGG - Intergenic
1051278983 9:15422769-15422791 GGCGAGCGGCGAGGCGGCGCGGG - Exonic
1057337409 9:94166541-94166563 GGCGGGTGGCCCCGGGGGGCCGG + Intergenic
1057354954 9:94325216-94325238 TGTGAGTGTCCTCGGGGCGCCGG - Exonic
1057652798 9:96932418-96932440 TGTGAGTGTCCTCGGGGCGCCGG + Exonic
1061248543 9:129413816-129413838 GGGGAGGGGCCGGGCGGCGCGGG - Intergenic
1061588673 9:131584289-131584311 GGTGAGTGGCCTTGGGGCGTGGG - Exonic
1062392852 9:136340843-136340865 GGCGAGTGGGGTGGCGGAGCGGG - Intronic
1062431248 9:136527754-136527776 GCTCAGTGGCCTGGCGGCGCTGG + Intronic
1185465629 X:352870-352892 AGCGAGTGACATCGCGGAGCCGG + Intronic
1185621342 X:1452934-1452956 GGGGCGTGGCCTCGCGGAGGCGG - Intronic
1187915447 X:24149479-24149501 GCCCAGTGGCCTCGCTGCGGCGG - Intronic