ID: 1112416222

View in Genome Browser
Species Human (GRCh38)
Location 13:99205583-99205605
Sequence CATTAAAATGTCCTGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 270}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112416222_1112416230 -1 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416230 13:99205605-99205627 GGACAAACAGATTGAGATGGAGG 0: 1
1: 0
2: 4
3: 16
4: 206
1112416222_1112416231 3 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416231 13:99205609-99205631 AAACAGATTGAGATGGAGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 406
1112416222_1112416233 7 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416233 13:99205613-99205635 AGATTGAGATGGAGGCAGGAGGG 0: 1
1: 0
2: 3
3: 88
4: 837
1112416222_1112416235 21 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416235 13:99205627-99205649 GCAGGAGGGCAGCCACAGGCAGG 0: 1
1: 0
2: 9
3: 71
4: 652
1112416222_1112416232 6 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416232 13:99205612-99205634 CAGATTGAGATGGAGGCAGGAGG 0: 1
1: 0
2: 2
3: 42
4: 445
1112416222_1112416234 17 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416234 13:99205623-99205645 GGAGGCAGGAGGGCAGCCACAGG 0: 1
1: 1
2: 6
3: 88
4: 765
1112416222_1112416236 22 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416236 13:99205628-99205650 CAGGAGGGCAGCCACAGGCAGGG 0: 1
1: 0
2: 9
3: 81
4: 576
1112416222_1112416229 -4 Left 1112416222 13:99205583-99205605 CCCCACCCCAGGACATTTTAATG 0: 1
1: 0
2: 5
3: 18
4: 270
Right 1112416229 13:99205602-99205624 AATGGACAAACAGATTGAGATGG 0: 1
1: 0
2: 0
3: 31
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112416222 Original CRISPR CATTAAAATGTCCTGGGGTG GGG (reversed) Intronic
902240435 1:15084732-15084754 CATTAACTTCTACTGGGGTGGGG - Intronic
906973513 1:50544429-50544451 CATCAAAATTACCTGGGGTGGGG - Intronic
907597444 1:55732866-55732888 TATTAAAATCTCCTGTGCTGAGG - Intergenic
907922638 1:58927971-58927993 CACTAGAATTGCCTGGGGTGGGG - Intergenic
912272494 1:108225448-108225470 CACTTACATGGCCTGGGGTGTGG - Intronic
912295727 1:108468874-108468896 CACTTACATGGCCTGGGGTGTGG + Intronic
913119892 1:115730181-115730203 AATTAAAATTTCCAGGGCTGGGG + Intronic
913711107 1:121484525-121484547 AATTAAAATGTCCTGGGGAGAGG + Intergenic
915452336 1:156014892-156014914 CCTTAAAATCTCTTGTGGTGGGG - Intronic
916464558 1:165061309-165061331 AATAAAAATGCCCTGGGGTTAGG - Intergenic
919373527 1:196763097-196763119 AGTTAAAATGTTGTGGGGTGGGG + Intergenic
919379968 1:196847774-196847796 AGTTAAAATGTTGTGGGGTGGGG + Intronic
922187916 1:223292775-223292797 CACTAAAATGTCCTTGGCTTTGG - Intronic
922244707 1:223784446-223784468 CAATAAAATGTCCTGAGGTGGGG + Intronic
923237947 1:232052692-232052714 CATTAAAATGTACTTGGCTGTGG + Intergenic
924103493 1:240627814-240627836 CATGAAAATGTGCTGGAGTTTGG - Intergenic
924133164 1:240933621-240933643 CATTAAAATGTCCTAATGTATGG - Intronic
924587946 1:245376448-245376470 CATTTAATTCGCCTGGGGTGTGG - Intronic
1062895688 10:1101502-1101524 CATTCTGAGGTCCTGGGGTGAGG + Intronic
1064978052 10:21138515-21138537 CAATAAAATGTCATCGGGAGAGG + Intronic
1064995562 10:21294134-21294156 AATGAAAATGTGCTGGGGGGAGG - Intergenic
1065058499 10:21872606-21872628 CATTGAAATGATCTGGGCTGAGG + Intronic
1066528503 10:36308947-36308969 GATTATAATGTCTTGTGGTGTGG - Intergenic
1068143000 10:53029290-53029312 CTTTAAATTGTCCTGATGTGGGG + Intergenic
1068724458 10:60285714-60285736 CATGGAAATGTCTTGGGGTGAGG - Intronic
1069737006 10:70663279-70663301 CTCTAAAATGACCTCGGGTGTGG + Intergenic
1070531221 10:77339103-77339125 TATTAAAATCTCATGGGGAGGGG + Intronic
1070557809 10:77542739-77542761 CATCTAAAAGACCTGGGGTGAGG + Intronic
1071284846 10:84135082-84135104 CATTAAGATGTCATGGGGGAGGG - Intergenic
1073450202 10:103604575-103604597 GAGGAAAAGGTCCTGGGGTGGGG + Intronic
1073462900 10:103676774-103676796 CACACAAATGCCCTGGGGTGGGG - Intronic
1074439628 10:113465292-113465314 AAATAAAATCTCCTGGGGAGAGG - Intergenic
1076475246 10:130747106-130747128 CATGAAACTGTCCTGGAGAGAGG - Intergenic
1078567769 11:12431571-12431593 CATTTAAAAGACCTAGGGTGTGG - Intronic
1079403873 11:20128329-20128351 GATCAGAATGTCCCGGGGTGGGG + Intergenic
1080971142 11:37278894-37278916 CAGTAAAATGTGGTGAGGTGTGG + Intergenic
1081521054 11:43881297-43881319 CATTAAGAATTCCTGGGTTGAGG + Intronic
1083471618 11:62888090-62888112 CTTTAAAAAGGCCTGGGGTCAGG - Intronic
1084322031 11:68378431-68378453 CACTGAATTGCCCTGGGGTGTGG - Intronic
1085243913 11:75082289-75082311 CAATAAATAGTGCTGGGGTGGGG + Intergenic
1085964622 11:81507021-81507043 CATAAAAATGACCTGAAGTGAGG - Intergenic
1086113124 11:83219805-83219827 CTTTAAATTGTCCTGATGTGGGG + Intronic
1088213336 11:107480692-107480714 ATTTAAATTGGCCTGGGGTGTGG + Intergenic
1088568206 11:111195679-111195701 CATTCAAATAGACTGGGGTGAGG - Intergenic
1088757967 11:112902514-112902536 CATGAGAATGGCCTGGTGTGGGG - Intergenic
1090991987 11:131826009-131826031 GAATAAAATGTCTTGGGGAGAGG + Intronic
1093816121 12:23549655-23549677 CATGTAAAAGTCCTGGGGTATGG + Intronic
1095175515 12:39087644-39087666 TTTTAAAATGTCCTGAGTTGAGG - Intergenic
1095526685 12:43134550-43134572 CATCACACTGTCCTGGGGTTGGG - Intergenic
1096281093 12:50254541-50254563 CACTAAATTGTCCTAGGGTAGGG + Intronic
1097575113 12:61382709-61382731 AGTTAAAACCTCCTGGGGTGAGG - Intergenic
1101958933 12:109233736-109233758 CATCAAAATTTCTGGGGGTGCGG - Exonic
1103137335 12:118518964-118518986 CACCAAAATGTCTGGGGGTGGGG - Intergenic
1103507244 12:121449827-121449849 CATGGAAATGTCCTGGGGTTCGG + Intronic
1103545674 12:121699454-121699476 GATGAAAATGTCCTGGAGTTAGG + Intergenic
1104219982 12:126773341-126773363 CATTCTAATCTCCTGGGGAGAGG + Intergenic
1107098188 13:36559376-36559398 CCTTAAAATGCCCTGGAGAGTGG - Intergenic
1108070560 13:46624629-46624651 TATGAAAATGTCCTGAGATGGGG + Intronic
1108593014 13:51927255-51927277 TATTAATAGTTCCTGGGGTGGGG - Intergenic
1109248068 13:59982421-59982443 AATTAGAAGTTCCTGGGGTGGGG - Intronic
1109272163 13:60267346-60267368 CTTTAAATTGTCCTGATGTGGGG + Intergenic
1110378711 13:74824582-74824604 CCTGGAAATGTCCTGGGCTGAGG - Intergenic
1110652506 13:77958668-77958690 CATTAAAATAACCTGGGGGCTGG - Intergenic
1112416222 13:99205583-99205605 CATTAAAATGTCCTGGGGTGGGG - Intronic
1114254008 14:20986437-20986459 CATTAAAATGTTCTGGGTTGGGG - Intergenic
1114282557 14:21206640-21206662 CATTAAAATTTCCTGGGAGCAGG - Intergenic
1115752779 14:36507562-36507584 CACTAATCTGCCCTGGGGTGAGG - Intronic
1116278551 14:42870170-42870192 CAATAACATGACATGGGGTGTGG + Intergenic
1116326225 14:43535912-43535934 CTTTAAATTTTCCTGGTGTGGGG - Intergenic
1116531518 14:45978649-45978671 CAGTAAAATGTCCAGTGGTGTGG - Intergenic
1116899919 14:50351432-50351454 TATTAAAATGAGTTGGGGTGGGG + Intronic
1117045101 14:51805675-51805697 TATTAAGATGTGCTGGAGTGGGG - Intergenic
1117406025 14:55404905-55404927 CATTAATAACTCATGGGGTGAGG + Intronic
1117638631 14:57774239-57774261 CAGGAACAAGTCCTGGGGTGTGG - Intronic
1117914594 14:60663807-60663829 CATCAAAATTATCTGGGGTGCGG - Intergenic
1118470074 14:66067373-66067395 GATTCAATTGGCCTGGGGTGGGG - Intergenic
1118808372 14:69256858-69256880 ATATAAGATGTCCTGGGGTGGGG - Intergenic
1118921773 14:70156084-70156106 CATGAAAAAGGCCTGCGGTGGGG + Intronic
1120040146 14:79743516-79743538 TATTAAAGTGTTGTGGGGTGGGG - Intronic
1120214870 14:81670501-81670523 CATCAAAATATGCTGGGGAGAGG - Intergenic
1120921725 14:89761431-89761453 GATTTAATTGGCCTGGGGTGGGG + Intergenic
1121472165 14:94164471-94164493 AATTACAATGTCTGGGGGTGAGG + Intronic
1121484356 14:94303220-94303242 CTTTAAAGTTTCCTGGGGCGGGG - Intergenic
1122218790 14:100222203-100222225 CTTTAAAATGCCATGGGCTGTGG + Intergenic
1123689458 15:22824788-22824810 TATTAAAATGTCTTGGGTGGGGG - Exonic
1123715329 15:23025195-23025217 AATAAAAATTTCCTGAGGTGGGG - Intronic
1125125176 15:36211544-36211566 CCATAAAAGGTCCTGGAGTGTGG - Intergenic
1126546820 15:49883027-49883049 GATTTAATTGGCCTGGGGTGTGG - Intronic
1128080176 15:64852487-64852509 CTTTAAAATATCCTGAGGTCTGG + Intronic
1128331968 15:66761888-66761910 CATGTGAATGTCATGGGGTGAGG - Intronic
1128768336 15:70264629-70264651 CTTTGACATGTCCTGGGGTCTGG - Intergenic
1129062315 15:72869867-72869889 GATCAAAATGTCCAGGGGTGGGG - Intergenic
1131048467 15:89331295-89331317 AATTAAAATGTGGGGGGGTGGGG - Intronic
1131176984 15:90215909-90215931 TTTTAAATTGGCCTGGGGTGAGG - Intronic
1131233631 15:90677872-90677894 CATTTAATTGGCCTGGGGTGGGG - Intergenic
1131542081 15:93283038-93283060 GATTGAAATGTCCTGATGTGAGG - Intergenic
1131984819 15:98032557-98032579 AATTAAAATTTTCAGGGGTGGGG - Intergenic
1133760206 16:8792495-8792517 AATCAGAATATCCTGGGGTGAGG + Intronic
1133867494 16:9657995-9658017 CATTAAAAAGTCAGGGGATGGGG - Intergenic
1135205912 16:20483836-20483858 AATTGAAAAGTCCAGGGGTGGGG + Intronic
1137385234 16:48035770-48035792 GATTACTATGTCTTGGGGTGGGG - Intergenic
1139321596 16:66118643-66118665 CCTTGCAAAGTCCTGGGGTGGGG + Intergenic
1140699131 16:77565085-77565107 AGTTAAAATGTCCTGGGGACTGG + Intergenic
1141569494 16:84925583-84925605 CATTAAGAAGTCCTGGGGATGGG - Intergenic
1145041006 17:19578545-19578567 CATTAAGCCTTCCTGGGGTGCGG + Exonic
1146314223 17:31794657-31794679 CTGTAAAATGGCCTGAGGTGGGG - Intergenic
1146771112 17:35569365-35569387 CTTTAAAATGCCCAGGTGTGGGG - Intergenic
1147656304 17:42093030-42093052 GATTAAGATTTCCTTGGGTGGGG - Intergenic
1147817025 17:43217601-43217623 CATTATACTGTCTGGGGGTGGGG - Intronic
1148385231 17:47229567-47229589 AATCAAGAGGTCCTGGGGTGAGG - Intergenic
1149421734 17:56518370-56518392 CTATAAAATGTGCTGGGGTGGGG - Intergenic
1149743384 17:59070068-59070090 CTTTCAAATGGCCTGGGGTATGG + Intronic
1152413561 17:80144151-80144173 CAGTAAGTTGTCCTGGGGTGCGG - Exonic
1153492997 18:5669284-5669306 CAGTAATGTCTCCTGGGGTGGGG + Intergenic
1155491052 18:26402249-26402271 CATTCAAAAGGTCTGGGGTGGGG - Intergenic
1157154443 18:45251799-45251821 CATTCTAAGGTCCTGGGGTAAGG + Intronic
1157159803 18:45303465-45303487 CACTAAAGTGTCCAGGGATGGGG + Intronic
1158934858 18:62354913-62354935 CTTAAAAACGTGCTGGGGTGGGG - Intronic
1159179795 18:64887869-64887891 CAGTAAATTGTAATGGGGTGAGG - Intergenic
1160724493 19:611713-611735 CATGAGAATGTTCTGGAGTGAGG - Intronic
1162240902 19:9353536-9353558 CATAAAAAAGTCCTTGGGTTTGG - Intronic
1165184399 19:34004384-34004406 CATAAAAATGTCCTTGGCTCGGG - Intergenic
1165425735 19:35744529-35744551 CACTCACATGACCTGGGGTGGGG + Intronic
1166585505 19:43944062-43944084 CATTATGATGTGCTGGGGTATGG + Intergenic
1168162986 19:54524710-54524732 CGTGCAAAAGTCCTGGGGTGAGG + Intergenic
925529925 2:4848140-4848162 CAGTAAAATTTCCTTGGGTAGGG - Intergenic
926324705 2:11774469-11774491 CATTAAAATCTCATGGTGGGTGG + Intronic
927445809 2:23160606-23160628 CATTAAAATATCTTGGTGTGGGG - Intergenic
928098822 2:28423021-28423043 CAGGACAATGGCCTGGGGTGGGG - Intergenic
929212035 2:39367781-39367803 TATTAAAATTTCTTGGGGAGAGG - Intronic
930565413 2:53013199-53013221 CTTTAACATTTCCTGGAGTGTGG - Intergenic
930610720 2:53539916-53539938 AATTCAAAGGTACTGGGGTGGGG + Intronic
931109662 2:59097061-59097083 CATGTGAATGTCCAGGGGTGAGG - Intergenic
932265534 2:70364416-70364438 CATTAGAATACCCTGGGGAGTGG - Intergenic
932488878 2:72105696-72105718 CATTTAATTGGTCTGGGGTGTGG + Intergenic
933326558 2:80845127-80845149 CTTTAAAATGTGCTGAGGTAAGG - Intergenic
933582998 2:84148474-84148496 CATCAAACTGTCCTGGAGAGTGG - Intergenic
936746149 2:115578973-115578995 AATTAAAATCACTTGGGGTGAGG - Intronic
938199055 2:129358141-129358163 CTTAAGGATGTCCTGGGGTGAGG + Intergenic
938727069 2:134118778-134118800 TATTAAAAGGTCCTGGGGTCAGG + Intergenic
939873875 2:147554726-147554748 CTGCAAAATGTCCTGGGATGGGG + Intergenic
940103974 2:150076564-150076586 AATTTAAATATCCTGGGGTGGGG + Intergenic
941464721 2:165812576-165812598 CAAAAAAATGTCCTGGAGAGAGG - Intergenic
941588442 2:167388702-167388724 GATTTAATTGACCTGGGGTGAGG - Intergenic
941657051 2:168155566-168155588 AATTAAAATCTGTTGGGGTGGGG - Intronic
943474224 2:188334476-188334498 GATTAAAATCTCTGGGGGTGTGG + Intronic
948042627 2:234915337-234915359 CATTAAAATCTCTTTGGGTTTGG - Intergenic
1169386584 20:5155172-5155194 GGTTAAAATGACTTGGGGTGGGG - Intronic
1169835081 20:9868905-9868927 AGTTAAAGAGTCCTGGGGTGGGG - Intergenic
1170388355 20:15845268-15845290 CATAAAAATGTCCAGGACTGAGG + Intronic
1174324647 20:49769526-49769548 AATTCAAATGTGCTGGGGAGTGG - Intergenic
1175202477 20:57287543-57287565 CTTAATAACGTCCTGGGGTGGGG + Intergenic
1175422723 20:58845375-58845397 TATTAAAATGTCATGGGGAGGGG - Intronic
1180616198 22:17129525-17129547 CAATAAAATTAGCTGGGGTGTGG + Intronic
1181962872 22:26635554-26635576 TATTAAAACTTCATGGGGTGGGG - Intergenic
949390586 3:3558100-3558122 AATTTAAATGGTCTGGGGTGAGG - Intergenic
949982783 3:9512927-9512949 CAAAAAAATGTCCTAGAGTGAGG - Intronic
951304388 3:21040514-21040536 CTTTTAAATGGCCTGGGGTATGG + Intergenic
952360856 3:32628672-32628694 CATTAAAAGGTCCACGGCTGAGG - Intergenic
955399595 3:58581905-58581927 AATTAAAATGTACTGGGGATGGG - Intronic
955972681 3:64451565-64451587 GATTTAATTGGCCTGGGGTGTGG - Intergenic
956868128 3:73389088-73389110 AATCAAAATGACCTGTGGTGAGG + Intronic
958092614 3:88895421-88895443 CATTAAAATGTCCTCGAGGTGGG + Intergenic
958960525 3:100505352-100505374 GATTAAAAAGTCATGGGTTGGGG - Intronic
959148074 3:102573686-102573708 AAATAAAACTTCCTGGGGTGAGG - Intergenic
959254814 3:103994837-103994859 CATTAAAGTGCCATGGGTTGAGG - Intergenic
959395600 3:105834069-105834091 AATCACAATTTCCTGGGGTGGGG + Intronic
959933476 3:112006845-112006867 CATTAAGAATTCCTGGGTTGGGG + Intronic
961742283 3:129040319-129040341 CATCAACATTTCCTGGGGTGTGG - Exonic
962223511 3:133584861-133584883 TATTAAAATTTCATGGAGTGGGG + Intronic
963241816 3:143011242-143011264 CATCATAATGTTCTGTGGTGGGG + Intronic
964233345 3:154496238-154496260 CCTTAAAATATCTTGGGATGTGG + Intergenic
964528760 3:157644482-157644504 CATTTAATTGGCCTGGGATGTGG - Intronic
964881921 3:161432537-161432559 CATCACCATGTCCTGGGTTGAGG + Intergenic
965962284 3:174442317-174442339 CATTAAGAATTCTTGGGGTGTGG - Intronic
966234589 3:177686656-177686678 CTTTAAAATGACATGGGGTGGGG - Intergenic
966259189 3:177955235-177955257 CACTTAAATATCCTGCGGTGGGG - Intergenic
966494938 3:180569272-180569294 CATTAAAATCTCCTGCCATGTGG + Intergenic
967261962 3:187651206-187651228 CACCAAAATGTCCTGGAGAGGGG - Intergenic
968494057 4:905738-905760 CAGTAACGTGGCCTGGGGTGTGG - Intronic
971147984 4:23999979-24000001 CATTAAAATGCTCTCGGGTGAGG + Intergenic
971230598 4:24798116-24798138 AATCAAAATCTCTTGGGGTGGGG + Intronic
972999144 4:44924179-44924201 CATTGAAATGTGTTGTGGTGAGG - Intergenic
975780395 4:77833209-77833231 CTTTAAAAGGGGCTGGGGTGGGG - Intergenic
976374059 4:84324429-84324451 GATTAAAGGGGCCTGGGGTGGGG - Intergenic
976522442 4:86044353-86044375 GATTTAATTGTTCTGGGGTGAGG + Intronic
979708570 4:123750282-123750304 CATTAAAATGACCTTGGGTGTGG + Intergenic
981815678 4:148828512-148828534 CATTAAAATCTAATGAGGTGAGG - Intergenic
981920589 4:150080113-150080135 CATTAGAATCACCTGGGGGGGGG - Intronic
982212086 4:153046098-153046120 CCTCAAAATATCCTGGTGTGGGG - Intergenic
982454938 4:155598148-155598170 CATTAGAATTGCCTGGGGAGTGG - Intergenic
985034499 4:185824449-185824471 CATTCACAAGTCCTGGGGTTAGG + Intronic
986280391 5:6317324-6317346 GATTAAAATGTGCTGGTCTGTGG + Intergenic
987181217 5:15370409-15370431 CTTTAAAATGGCCTTGGCTGTGG - Intergenic
988612983 5:32745399-32745421 CATTAAGATGCCCTTGAGTGAGG - Intronic
988951489 5:36266216-36266238 CATTAAAAAGTCAGGGAGTGTGG - Intronic
990473664 5:56141430-56141452 CATTCAGTTGTTCTGGGGTGGGG - Intronic
992222481 5:74586428-74586450 CAAAAAAAAGTTCTGGGGTGGGG + Intergenic
992650785 5:78857689-78857711 CAATAATATGTGCTGGGATGGGG - Intronic
993308059 5:86294540-86294562 CACTTACATGGCCTGGGGTGTGG + Intergenic
994261847 5:97668811-97668833 AATTAAAATCCCTTGGGGTGTGG + Intergenic
994941459 5:106328914-106328936 CCTTAAAATGTATTGTGGTGGGG + Intergenic
996218856 5:120903480-120903502 CATTAAATCGTTCTGGGGTTGGG - Intergenic
996449591 5:123604762-123604784 CATTTGAACGTCCTGCGGTGGGG - Exonic
997685658 5:135786074-135786096 GATTCTAATATCCTGGGGTGGGG + Intergenic
997805894 5:136917485-136917507 TCTTAGAATGTCCGGGGGTGGGG + Intergenic
998934838 5:147224076-147224098 CACTCAAATGTCCTGGGGTGGGG + Intergenic
1000248239 5:159468251-159468273 TATTAACAAGTCCGGGGGTGGGG - Intergenic
1001174827 5:169458547-169458569 CATTAAAATGTCAAGGTGGGAGG + Intergenic
1001365986 5:171140548-171140570 CATCAAAAGGACTTGGGGTGAGG - Intronic
1001900017 5:175419434-175419456 CTTTAACAAGTCCTGGGCTGAGG + Intergenic
1002711215 5:181195972-181195994 CATTAATCTGTCCAGGTGTGAGG + Intronic
1003532321 6:6948037-6948059 TATTATAATGACTTGGGGTGGGG - Intergenic
1004405274 6:15327348-15327370 TATGAAAATGTGCAGGGGTGGGG - Intronic
1005138167 6:22595813-22595835 CATTAAAATGTTTTAGGCTGAGG - Intergenic
1006833831 6:36985312-36985334 ATTTAAAACGTCTTGGGGTGGGG - Intronic
1007184597 6:39958342-39958364 CATTAAAAAGTCTTAAGGTGGGG - Intergenic
1007343441 6:41208860-41208882 CATTGGAAAGACCTGGGGTGGGG - Intergenic
1007759014 6:44121338-44121360 CCTTAAAAAGAGCTGGGGTGGGG + Intronic
1007983073 6:46179096-46179118 TATTAAAATGACCTTGGTTGAGG + Intergenic
1007990062 6:46245757-46245779 AATTAGAATCTCTTGGGGTGGGG + Intronic
1008107809 6:47459370-47459392 TATTAAAATGTCTTGGGAGGGGG - Intergenic
1008656688 6:53621493-53621515 CATTATAATGGCCAGGGCTGGGG + Intergenic
1009771643 6:68151292-68151314 TGTTAAAATGTCCTGGAGTTGGG - Intergenic
1010060393 6:71615828-71615850 CCTTCAAATGTGCTGAGGTGAGG - Intergenic
1010218737 6:73428889-73428911 CATGAAAATATCCTGGGGCTGGG + Intronic
1012166205 6:95955582-95955604 CAGTGAAATGTTCTGTGGTGAGG + Intergenic
1012437655 6:99231604-99231626 CATTAAATTGCTCTGGGGTGTGG + Intergenic
1012784657 6:103608315-103608337 AATTAAAATCTCTTGGGGTAGGG - Intergenic
1012784668 6:103608385-103608407 CATTAGAATCATCTGGGGTGGGG - Intergenic
1013944738 6:115708007-115708029 CAATAGAATGCCTTGGGGTGTGG - Intergenic
1015290359 6:131531949-131531971 CAGTATAATCTCCTGGTGTGCGG + Intergenic
1015662133 6:135587985-135588007 CATTAGAATCTCCTGGAATGGGG + Intergenic
1015686116 6:135863517-135863539 CATTAAAATTTCCTTGACTGGGG + Intronic
1016379487 6:143460500-143460522 CATTAAAATGTCCTAGGCAGTGG - Intronic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1018301902 6:162411830-162411852 AATTTAAATGTGGTGGGGTGAGG - Intronic
1018575443 6:165255161-165255183 CATTCAAATGTACTGGCGTTAGG - Intergenic
1019660572 7:2221518-2221540 CATGAAAATCTGCTGGTGTGGGG - Intronic
1020393211 7:7683298-7683320 GATTAAAAGGTCCTGGGATTAGG + Intronic
1020507050 7:9004153-9004175 CAGTAAAATGTCCGGAGGTAGGG - Intergenic
1020817376 7:12922303-12922325 AATTTATATGTGCTGGGGTGCGG - Intergenic
1021839012 7:24707086-24707108 AATGCAAATGTCCTGGGCTGTGG + Intronic
1021879100 7:25076651-25076673 GATTAAAATGGCCTGGGGAAGGG - Intergenic
1024434930 7:49341048-49341070 CGTTAAATTGCACTGGGGTGTGG - Intergenic
1024765836 7:52658348-52658370 CATTACAATTTTCTGGGGAGGGG - Intergenic
1026139830 7:67696304-67696326 CATGCAAAAGTCCTGGGATGTGG + Intergenic
1030531591 7:110717690-110717712 CATTAAGATGTCCTTGGATTAGG + Intronic
1032263947 7:130357369-130357391 CATTTAAAAGTTCTGGGCTGAGG + Intronic
1033047572 7:137976709-137976731 AATTAAAATGTCTGGAGGTGGGG - Intronic
1034521896 7:151626823-151626845 TATTAAAATGTCGTGGGGGTAGG - Intronic
1035895444 8:3395029-3395051 AATTTAAATGTGCTGGAGTGGGG + Intronic
1038298948 8:26324248-26324270 CAATAAAAAGTCATGGAGTGGGG - Intronic
1039247983 8:35630780-35630802 CAGAATAATGTACTGGGGTGGGG + Intronic
1043504297 8:80887258-80887280 CATTCAGTTGGCCTGGGGTGTGG - Intergenic
1044737900 8:95297737-95297759 CATTCACAGGTCCCGGGGTGAGG + Intergenic
1045221761 8:100206586-100206608 CAGTAAAATTTCCTGGGTTCCGG + Intronic
1046269953 8:111881847-111881869 CAATAAAATGACCTAGGGGGAGG - Intergenic
1046396252 8:113644122-113644144 GATTAAAATGTCCTTGAGAGAGG - Intergenic
1047510946 8:125514975-125514997 GATTCAATTGGCCTGGGGTGGGG - Intergenic
1048538084 8:135316285-135316307 CATTAGAATTGCCTGGGTTGGGG + Intergenic
1048780051 8:137990387-137990409 CTTTAAATTGTCCTGATGTGGGG - Intergenic
1049081004 8:140443493-140443515 CACTACAATGTTTTGGGGTGGGG + Intronic
1049878846 8:145047539-145047561 CATTAAAAAGTTCTAGGGTCGGG + Intergenic
1051044053 9:12852270-12852292 CCCTAAATTGTCCTGGAGTGAGG - Intergenic
1052610170 9:30760986-30761008 CATTAATATGTTCTTGGGTTTGG - Intergenic
1052732166 9:32300614-32300636 CATTAGTATTTCCTGGGGTCAGG + Intergenic
1053597977 9:39583164-39583186 CCTTAAAATGTTGGGGGGTGGGG + Intergenic
1053856001 9:42340173-42340195 CCTTAAAATGTTGGGGGGTGGGG + Intergenic
1056069064 9:82967132-82967154 CATTAACATTTCCTGGGCAGAGG + Intergenic
1060016540 9:120091488-120091510 CAAGAAAATGTTCTGGGTTGGGG - Intergenic
1060192511 9:121602050-121602072 CAGGAAAATGGCCTGGGTTGGGG - Intronic
1060222040 9:121769500-121769522 CATTAAAAAGTCCCTGGGGGTGG - Intronic
1061253254 9:129438517-129438539 CATCACAATGACCGGGGGTGGGG - Intergenic
1062619553 9:137413751-137413773 AATGAAAATGTTCTGGGCTGAGG - Intronic
1186260100 X:7768395-7768417 CAATAAAATTTGCTGGGATGTGG - Intergenic
1186503750 X:10073617-10073639 TATCAAAATCTCTTGGGGTGAGG - Intronic
1186514458 X:10156226-10156248 CAAGAATTTGTCCTGGGGTGTGG - Intergenic
1186831897 X:13399174-13399196 TATTAAAAAGTCCAGAGGTGAGG + Intergenic
1187148108 X:16656154-16656176 AGTTAAAATTTCCTGGGGGGTGG - Intronic
1187470094 X:19561993-19562015 CATTAAAAGGTCATTGGATGTGG - Intronic
1188826954 X:34847047-34847069 CAGTAAAATTTCCTGTGATGGGG - Intergenic
1189202195 X:39206028-39206050 CAGTAAAATCTCTTGGGGTCGGG - Intergenic
1189643000 X:43094401-43094423 CATGAAGTTGTCCTGGGGGGTGG + Intergenic
1191895677 X:65990111-65990133 CATTAAAATGTTCTGATGAGTGG + Intergenic
1192656149 X:72997245-72997267 CATTAAAAGGTCCTATGGTTGGG + Intergenic
1192665971 X:73085756-73085778 CATTAAAAGGTCCTATGGTTGGG - Intergenic
1192729250 X:73785947-73785969 CATTAATGTGTCCCAGGGTGAGG + Intergenic
1196663213 X:118290620-118290642 CATTAGAATTTCCTTTGGTGAGG - Intergenic
1196828766 X:119760060-119760082 CATTAATGGGTCTTGGGGTGCGG + Exonic
1199272836 X:145905090-145905112 CATTAAAATTCCTTGGGGAGGGG + Intergenic
1199699864 X:150367050-150367072 CAGTACAATGTGTTGGGGTGGGG + Intronic
1200072080 X:153534176-153534198 CAAGCAAAGGTCCTGGGGTGGGG + Intronic
1201237002 Y:11921432-11921454 CATTCACATGTTCTGGGGTCAGG - Intergenic