ID: 1112418162

View in Genome Browser
Species Human (GRCh38)
Location 13:99222154-99222176
Sequence CAGGGTTTACATTCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112418162 Original CRISPR CAGGGTTTACATTCTGATGA AGG Intronic
900785179 1:4644768-4644790 CTGGGTGTGCATTCTGATGAAGG - Intergenic
901806337 1:11740971-11740993 CAGGGTTTACTATCAGATGGAGG + Intronic
902592348 1:17484123-17484145 CAGGGCTTCCATTCTAATGTGGG + Intergenic
904226445 1:29024740-29024762 TTGGGTTTACATTCTGATAAAGG - Intronic
905401602 1:37707652-37707674 CTTGGTTTAAATTCTGAAGAGGG + Intronic
905505136 1:38472939-38472961 GAAGTTTTACATTTTGATGAAGG - Intergenic
906921700 1:50071263-50071285 TAGAGTTTACATTCAAATGAAGG - Intronic
906941595 1:50260402-50260424 GAGAGTTTGCATTCTGGTGAGGG + Intergenic
907702016 1:56797886-56797908 AAGAGTTTACATTCTGATGGAGG - Intronic
907935609 1:59039387-59039409 TGAGGTTTACATTCTGATGAGGG - Intergenic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
909493720 1:76254343-76254365 CAGTTTTTCCATCCTGATGAAGG - Intronic
910608873 1:89118003-89118025 TAGAGCTTACATTCTAATGATGG + Intronic
911089041 1:94002758-94002780 CAGGGTTTGCATTTTGAGGTAGG - Intronic
913038197 1:114995694-114995716 TAGAGCTTACATTCTGGTGAGGG + Intergenic
916197775 1:162240846-162240868 CAGAGTTCACAGTCTGATGGCGG + Intronic
916251265 1:162740677-162740699 CTGAGTTTACATTCTCATGTGGG - Intronic
916627863 1:166578768-166578790 CAGAGTATATATTCTGATAATGG + Intergenic
917974389 1:180229895-180229917 CTGGGTATAAATTCTGCTGATGG - Intergenic
918211862 1:182358320-182358342 CAGGGTCTAAACTCTTATGAGGG + Intergenic
918215212 1:182387425-182387447 CAGGGTATACATATTAATGATGG - Intronic
921972010 1:221160100-221160122 TAGGGTTTACAGTCTGGAGAAGG + Intergenic
923304675 1:232677212-232677234 CTTGGTTTACATTCTGTTAAAGG + Intergenic
924475975 1:244382172-244382194 CAGGGCTGACATTCTGGTGGGGG + Intronic
1063358698 10:5429217-5429239 CAGGGCTTACCTTCAGATCAAGG - Exonic
1063620519 10:7643190-7643212 CAGGGTTTGGGTTTTGATGAGGG - Intronic
1066231288 10:33436244-33436266 TGGGGTTTACTTTCTAATGAGGG + Intergenic
1066300508 10:34091675-34091697 CAGAATCTACATTCTGAGGATGG + Intergenic
1067906016 10:50291932-50291954 AAGGGTCTCCATTGTGATGATGG - Intergenic
1068711744 10:60142357-60142379 CTGGCAATACATTCTGATGAGGG - Intronic
1068862543 10:61862034-61862056 CAAGGTTTTCAATCTCATGATGG - Intergenic
1068891924 10:62156801-62156823 CAGGTTGTACATTCTGGTGAAGG + Intergenic
1070552835 10:77504348-77504370 CAGGGTGTAGACTATGATGAAGG - Intronic
1071111183 10:82158899-82158921 CAAGCTTTCCATTCAGATGAAGG + Intronic
1072627256 10:97120611-97120633 CAGGCTTTGCATCCTGCTGAGGG + Intronic
1072794649 10:98345327-98345349 GAGGGTTTACAGTCTAATGGGGG - Intergenic
1073613128 10:104964489-104964511 TAGAGCTTACATTCTGTTGAAGG - Intronic
1074175355 10:110995233-110995255 CTGGGTTTTCAGTCTGGTGAGGG + Intronic
1074876067 10:117614306-117614328 CAGGGTTTACATTCTAGTGGTGG + Intergenic
1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG + Intronic
1079780734 11:24599912-24599934 CATGGGTTACATTTTGTTGATGG + Intronic
1079989014 11:27227778-27227800 CACTGTTTAAATTTTGATGAGGG + Intergenic
1080957397 11:37115365-37115387 TGGGGTTTACATTCTGTTTAGGG + Intergenic
1081311107 11:41573699-41573721 CAGGGTTTAATTTCTAGTGAGGG - Intergenic
1082875213 11:57980947-57980969 TAGAGTTTACATTCTGCTGAGGG - Intergenic
1083318626 11:61831586-61831608 CAGGGTTTAGCTTCTGTGGAAGG - Intronic
1083370732 11:62177791-62177813 CTGTGTTAAGATTCTGATGAAGG + Intergenic
1085998382 11:81950218-81950240 CAGTGTTTATATCCTGATGGTGG - Intergenic
1087799679 11:102489903-102489925 CACAGTTTCCATTCTGCTGATGG + Intronic
1088416800 11:109598087-109598109 TAGTGTTTTCTTTCTGATGATGG - Intergenic
1092067161 12:5600317-5600339 AAGGGTTGAATTTCTGATGAGGG - Intronic
1092101771 12:5889419-5889441 GAGAGTTTACATGCTGCTGAGGG + Intronic
1093223585 12:16453020-16453042 CAGGATTCACATCCTCATGAAGG + Intronic
1093495698 12:19754257-19754279 TAGGGTTTACATTCTTTTGAGGG - Intergenic
1094417259 12:30230582-30230604 AAGTGCTTACAGTCTGATGAAGG + Intergenic
1094858927 12:34437059-34437081 CAGTGTTTCCAATCTGCTGAAGG + Intergenic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1099201434 12:79681878-79681900 CAGAGTTAACATTCAGAAGATGG - Intronic
1102420208 12:112797415-112797437 CTGGATTTACATTCTGTTGGGGG + Intronic
1102744331 12:115237035-115237057 CAGAGTTTACAATCTAGTGATGG + Intergenic
1103156711 12:118691578-118691600 CAGGGTTTAGTTTCTGGTGAGGG + Intergenic
1103245644 12:119454794-119454816 AAGGGTTTACATTTGGATGAAGG + Intronic
1103529744 12:121592676-121592698 CAGGGCTTACAGTCTGGTGAAGG - Intergenic
1106143634 13:27033162-27033184 AAGGGTTTACATTCTGGGGCAGG + Intergenic
1106386124 13:29287873-29287895 CAGGGTTCACAGGCTGATGGCGG + Intronic
1106563900 13:30869457-30869479 ACGGCTTTACAATCTGATGAAGG + Intergenic
1106916785 13:34524371-34524393 CAGGGTTTAAGTTCCAATGAGGG + Intergenic
1107129065 13:36875654-36875676 CATCGTTAACATTTTGATGAAGG - Intronic
1108167934 13:47712042-47712064 GAGGGCTTACATTCCAATGAGGG + Intergenic
1108961582 13:56239008-56239030 AGGAGTTTACATTCTAATGAGGG - Intergenic
1109181931 13:59224198-59224220 CAGGATTTGGTTTCTGATGAGGG + Intergenic
1109965863 13:69694475-69694497 CAGGGTTGAATTTCTGGTGAGGG + Intergenic
1110095183 13:71509492-71509514 CAGGGCTTAAATTGTAATGAAGG + Intronic
1110236173 13:73220277-73220299 CAGGGTTTACATTCTAATAGAGG - Intergenic
1110310069 13:74038658-74038680 CAGGGTTGATATTTTAATGATGG - Intronic
1110460185 13:75736600-75736622 AAGAGTTTACATTCTAGTGAAGG + Intronic
1110486707 13:76053247-76053269 CTGGTTTTTCATTCTTATGAGGG - Intergenic
1111246153 13:85544373-85544395 CAGGCATTAAATTATGATGAAGG + Intergenic
1111479336 13:88802616-88802638 CAGCGTTTAGATTCTGATCATGG + Intergenic
1111698469 13:91656366-91656388 CATTGTTTCCATTCTCATGATGG - Intronic
1112051605 13:95648781-95648803 CAGGTTTGAGTTTCTGATGAGGG + Intergenic
1112418162 13:99222154-99222176 CAGGGTTTACATTCTGATGAAGG + Intronic
1112606097 13:100908418-100908440 TTGAGTTTACACTCTGATGATGG - Intergenic
1115232247 14:31173640-31173662 CCTGGTTTGCATGCTGATGATGG + Exonic
1115619193 14:35124010-35124032 CTGTGTTTACATCTTGATGAAGG - Exonic
1116508818 14:45718580-45718602 CAGAGTTTACATTAGGCTGAAGG + Intergenic
1118923987 14:70174757-70174779 GAGAGTTTATTTTCTGATGAGGG + Intronic
1121426328 14:93854737-93854759 CAGGGTGTGGATGCTGATGAGGG + Intergenic
1121555168 14:94830982-94831004 CAAGGTTTAGTTTCTGACGAGGG + Intergenic
1121706405 14:95998625-95998647 AAAGGTTTACAAGCTGATGAGGG + Intergenic
1122282660 14:100633252-100633274 ATGGGCCTACATTCTGATGACGG - Intergenic
1124322394 15:28724975-28724997 CATGGCTTACATTATTATGAAGG + Intronic
1125413401 15:39428275-39428297 TAGGGCTTACATTCTAATGGGGG + Intergenic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126486620 15:49188199-49188221 CAGGGTTTACAGCCTTATAAAGG + Intronic
1126672904 15:51132583-51132605 CAGGGCTTAGTTTCTGGTGAGGG - Intergenic
1129341542 15:74889771-74889793 GAGCGCTTACATTCTGGTGAAGG - Intergenic
1130239190 15:82169885-82169907 CAGAGTTTAAAATCTGGTGAGGG + Intronic
1131774656 15:95781587-95781609 ATGGGTTTACATTGTGATTAGGG + Intergenic
1131850517 15:96538345-96538367 CAGGCTTTGCATTCTGATATGGG - Intergenic
1134133042 16:11662715-11662737 TGGGGTTTACATTCTCCTGAGGG - Intergenic
1134857195 16:17530112-17530134 CAGGGCTTGCATCCTGTTGAAGG - Intergenic
1136287149 16:29251199-29251221 CACAGTTTACATTCTAACGAAGG - Intergenic
1136407815 16:30058938-30058960 CAGGGCTTCCATTCTGGTGATGG + Exonic
1136738268 16:32484423-32484445 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1139679866 16:68553156-68553178 CGGGGTTTACATTCTGCTTTGGG + Intronic
1140544529 16:75793507-75793529 CAGTGTTTGCATTCTGTTTAAGG - Intergenic
1141234157 16:82199932-82199954 CAGAGTTTACATTCTGTGGGAGG + Intergenic
1141876947 16:86831698-86831720 CAGGGATTAGATTCTCATAAGGG - Intergenic
1141928374 16:87184185-87184207 CAGGGTTCACAGTCTGATGGGGG + Intronic
1142092756 16:88223831-88223853 CACAGTTTACATTCTAACGAAGG - Intergenic
1142519025 17:492187-492209 CAGGTTTTACCTTCTGTGGAGGG - Intergenic
1143103871 17:4518923-4518945 CAAGGTTTACATCCTGAGTAGGG + Intronic
1144513080 17:15894335-15894357 CAGGGATCACATTTAGATGAGGG + Intergenic
1146404572 17:32526173-32526195 CAGGGTTTACAATCTGGTGGGGG - Intronic
1147725506 17:42564163-42564185 CAGGGGTTACATTCTCAAGGCGG - Exonic
1148740971 17:49892338-49892360 TGGGGCTTACATTCTAATGAAGG + Intergenic
1149518041 17:57295139-57295161 TGGGGTTTAGCTTCTGATGATGG + Intronic
1153745163 18:8171207-8171229 CAGTGTTTACTGTCTGAGGAAGG + Intronic
1154040333 18:10848836-10848858 AAGTGTTTACATTATGATGAAGG + Intronic
1155513035 18:26596362-26596384 CAGGATTCACTTTCTGGTGAGGG - Intronic
1155579652 18:27288533-27288555 CAGGGTTCATTTCCTGATGAGGG - Intergenic
1155664240 18:28288164-28288186 CAGGGTTTACATTAAGAATAAGG + Intergenic
1156708097 18:39908182-39908204 AAGGGTTTAAATTATGATAAAGG + Intergenic
1159244205 18:65783814-65783836 CACAGTTTACATTCTAGTGAGGG + Intronic
1159592723 18:70352501-70352523 CAGAGTCGACATTCTGATGGAGG + Intergenic
1159832413 18:73293581-73293603 CTGGCTTTCCATCCTGATGATGG + Intergenic
1160033671 18:75282673-75282695 CAGGGTTTGGTTTCTGGTGAGGG - Intronic
1160252909 18:77219475-77219497 AAGTTTTTAAATTCTGATGAAGG - Intergenic
1164456657 19:28413215-28413237 CAGAGTTTACAATCTGATGGGGG - Intergenic
929512544 2:42576164-42576186 CAGGGTCCACATTCTAATGAGGG + Intronic
929883293 2:45855938-45855960 CAGGGTTTTCATGATGATGATGG + Intronic
930581760 2:53220087-53220109 CAGGGTCTGGTTTCTGATGAGGG - Intergenic
932541641 2:72661163-72661185 CAGAGTTTACCTTGGGATGAAGG + Intronic
932926414 2:75980079-75980101 CTGAGTTTACAGCCTGATGAGGG + Intergenic
935093143 2:99916386-99916408 CAGGGCTCAAATTCTGATGAGGG - Intronic
935573714 2:104688132-104688154 CAGAGTTCACATTCTCATCAGGG - Intergenic
935722109 2:105988823-105988845 CAGGCTTTGCATTCTCATTATGG - Intergenic
939980816 2:148778545-148778567 CAGGGTTTACTTACTGGTGGTGG - Intronic
941275498 2:163485669-163485691 CAGGGTTTAAATTCTAAAGAAGG - Intergenic
944160444 2:196653907-196653929 ATCGGTTTACCTTCTGATGAGGG + Intronic
944185098 2:196939573-196939595 CAGAGACTACATTCTGATGTGGG + Intergenic
946042798 2:216796925-216796947 CAAGGTTGACATGCTGAGGATGG + Intergenic
946419913 2:219558889-219558911 CAGAGTTTAAACTCTGGTGAGGG - Intronic
948884484 2:240875952-240875974 CAGGCTGTACAGGCTGATGACGG - Exonic
1169358135 20:4924879-4924901 CAGGGCTTTCATTCTGGTGTGGG - Intronic
1171104643 20:22420986-22421008 CAAGATTTCCATCCTGATGAAGG + Intergenic
1175613935 20:60376546-60376568 CAGGGCTTACTTTCTGATGACGG + Intergenic
1178256822 21:31060858-31060880 CAGGGACTCCGTTCTGATGAGGG - Intergenic
1180703814 22:17796652-17796674 CAGGTGTGACATTCTGATCAGGG - Intronic
1184373741 22:44098729-44098751 CAGAGTTTACACTCTGCTGCCGG + Intronic
949113167 3:287240-287262 TAGAATTTACATTCTAATGATGG - Intronic
949141446 3:638189-638211 CAGGGTTCAGTTTCTGGTGAGGG - Intergenic
949367582 3:3299846-3299868 AAGAGTTTACATTCTAATAAGGG - Intergenic
950830766 3:15873529-15873551 CTGACTTTACATTCTGATGCTGG - Intergenic
951256046 3:20450940-20450962 CCGGCTTTACAGTCTGGTGAGGG - Intergenic
951344246 3:21527296-21527318 CTTGGTTTACATCCTCATGATGG + Intronic
953592107 3:44268243-44268265 AAGGGTTCATTTTCTGATGAGGG + Intronic
954477342 3:50759998-50760020 CAAGTTTTAAATTTTGATGAAGG + Intronic
955201821 3:56858527-56858549 GTGGGTTTACCTTCTGGTGAGGG + Intronic
955768241 3:62367187-62367209 CAGGCTTAAAATTCTGAAGAGGG - Intergenic
957385779 3:79495063-79495085 CAGAGTATACATTCTAATCAGGG - Intronic
958564281 3:95787937-95787959 CTGGGTTTCCATTCTTTTGAGGG - Intergenic
959363085 3:105419847-105419869 CATGATTCACATTCTGAAGAAGG + Intronic
959737222 3:109673408-109673430 GATGGCTTACATTCTAATGAGGG - Intergenic
963795930 3:149630913-149630935 CAAGGTTCACAATCTAATGATGG + Intronic
964544880 3:157822835-157822857 CAGAGTTTACATTCTGGTGGGGG - Intergenic
964610236 3:158605962-158605984 CAAGGTTAACATTCTGAAGCTGG + Exonic
965317064 3:167205346-167205368 CATGGCTTACATTCTCATGCTGG - Intergenic
966509956 3:180751112-180751134 CAAGGTTCAATTTCTGATGAGGG - Intronic
966622114 3:181976622-181976644 TAGGGTTTACAATCTGGTGGGGG + Intergenic
967711710 3:192715970-192715992 CAGGGATAGCATTCTCATGAGGG - Intronic
969065246 4:4474271-4474293 CAGAGTTTGCAGTCTGGTGAAGG - Intronic
969865776 4:10076207-10076229 CACGGCATACATCCTGATGAAGG + Intronic
971708653 4:30082325-30082347 TGGAGTTTACATTCTGTTGAGGG + Intergenic
973174773 4:47191614-47191636 CAGTGTTTTCACTCAGATGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
978775514 4:112502475-112502497 TGGAGTTTACATTCTAATGAGGG + Intergenic
978800967 4:112755041-112755063 CAGGGTTTAAAGTCTGATAGTGG + Intergenic
979774139 4:124566442-124566464 CAGAGTTTATAATCTGGTGAGGG - Intergenic
980896094 4:138861985-138862007 CAGAGCTTACATTCTAATAAAGG + Intergenic
981076192 4:140594931-140594953 CTGGGTTTTCATTTTGATTAGGG + Intergenic
981636152 4:146882086-146882108 CAGGGTTTTATTACTGATGATGG + Intronic
982577121 4:157127393-157127415 CAGGGTTTGCACTCTGTTGTTGG + Intronic
983654116 4:170064212-170064234 AAGGGTTTGTTTTCTGATGATGG - Intronic
984575637 4:181445066-181445088 CAGGTGTTTCATTCTGATCAGGG + Intergenic
985381153 4:189396477-189396499 AAGGGTTTGCTTTCTCATGAGGG - Intergenic
986802950 5:11280425-11280447 CAGGTTTTGATTTCTGATGAGGG + Intronic
988650448 5:33143094-33143116 CAGGGTGAAACTTCTGATGATGG - Intergenic
989830414 5:45910506-45910528 CAGTGTTTACAAACTGCTGAAGG - Intergenic
989997729 5:50855609-50855631 AAGGGTTTCCACTCTCATGAAGG - Intergenic
990203681 5:53406194-53406216 CAGGGTTTGATTTCTGGTGAGGG - Intergenic
990279203 5:54231683-54231705 GAGGGTTCAGTTTCTGATGAGGG + Intronic
991337878 5:65570673-65570695 CAGGGTTTGATTTCTGATGAGGG + Intronic
992531013 5:77651839-77651861 CAGGGCTTGCATTCTGCTCAGGG - Intergenic
995097671 5:108258264-108258286 CAGGGTTTGATTTCTGGTGAGGG - Intronic
995893040 5:116978284-116978306 TAGAGTTTACATTCTAGTGAAGG - Intergenic
997923104 5:138001619-138001641 CATGGTTTACTTTCTAGTGATGG + Intronic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
998731104 5:145078282-145078304 CAGGGTTGACATATTGCTGAAGG + Intergenic
998801377 5:145872965-145872987 CAGGGTCAACTTTCTGCTGATGG - Exonic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
999692799 5:154163264-154163286 CAGAGTTTATAGTCTAATGAGGG + Intronic
1000570893 5:162912537-162912559 CGAAGTTTACATTCCGATGAGGG - Intergenic
1000733095 5:164860906-164860928 CAGGATTTACCTTCTGCTGCTGG + Intergenic
1001185395 5:169566727-169566749 TAGGGCTTACATTATAATGAAGG + Intergenic
1003239158 6:4327629-4327651 CAGAGATTACATCCTAATGAGGG - Intergenic
1005614618 6:27560690-27560712 CAGTGTTTTCACTCAGATGAAGG + Intergenic
1009324010 6:62327875-62327897 CAGGGTTTGGTTTCTGGTGATGG + Intergenic
1009941362 6:70292391-70292413 CTGGTTTTACATTCTGATTCTGG - Intronic
1010028205 6:71244268-71244290 TAGGGTTTACATTGTGTTGGGGG + Intergenic
1010292755 6:74157598-74157620 TAGGGTTTATATGCTGATGTGGG - Intergenic
1010375074 6:75158395-75158417 CAGGGTTTGATTTCTGGTGAGGG - Intronic
1010535905 6:77029943-77029965 CAGAGTTTACATTTTAGTGACGG - Intergenic
1012394410 6:98779652-98779674 GAGGGTTTTAATTGTGATGATGG + Intergenic
1012628316 6:101431402-101431424 CAGAGTTTATATTCTGGTGCTGG + Intronic
1014368991 6:120581464-120581486 CAGGGTTGTCAATCAGATGATGG + Intergenic
1014487875 6:122022797-122022819 CAGGGTCTAAATACTCATGAGGG - Intergenic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1014786267 6:125623416-125623438 CAGGGCTTACATTCTTTTGGGGG + Intergenic
1014998602 6:128185888-128185910 CAGGTTTTACCTTCTTATGCAGG + Intronic
1015280891 6:131433081-131433103 CAGGGTGTCCATTCTAAAGATGG - Intergenic
1016969273 6:149747652-149747674 TAGGATTTACATTCTAATGGGGG - Intronic
1018283697 6:162215205-162215227 CAGGCTTTAGATTCTTTTGAAGG + Intronic
1023512074 7:40963930-40963952 CAGGATATCCCTTCTGATGATGG - Intergenic
1025236245 7:57236676-57236698 CTGGCTTTAGCTTCTGATGATGG + Intergenic
1025526516 7:61819572-61819594 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025549892 7:62232128-62232150 CAGTGTTTACAAACTGCTGAAGG - Intergenic
1025579856 7:62698650-62698672 CAGGGTTTCCAAACTGCTGATGG + Intergenic
1028563698 7:92204593-92204615 CAGGCATTACATTCTCATAAGGG + Intronic
1028827864 7:95294457-95294479 AATGGTTTACATTATGATGGGGG + Intronic
1029820971 7:103146788-103146810 CAGTGTATATATTCTGCTGAAGG + Intronic
1031361347 7:120852378-120852400 CAGACTTTACATTCTGACTATGG - Intronic
1033455362 7:141498235-141498257 CAAGGCTTACATTCTGAACAGGG + Intergenic
1033925007 7:146447664-146447686 CAGGTTTAACAATTTGATGAAGG + Intronic
1035463147 7:159058554-159058576 CACGTTTTATATTCTGGTGAAGG - Exonic
1036436112 8:8735109-8735131 CAGGTTACACATTCTCATGAAGG - Intergenic
1036573732 8:10004841-10004863 CAGTATTAACATTCTGATGCTGG - Intergenic
1037839889 8:22237102-22237124 TAGGGCTTACATTCTGGTGGGGG + Intergenic
1037962412 8:23107527-23107549 AAGTGTTTACATTCTATTGAAGG - Intronic
1038019023 8:23537376-23537398 TGGGGCCTACATTCTGATGAGGG - Intronic
1038486170 8:27936663-27936685 CAGGGTTTATTTGCAGATGATGG - Intronic
1038927456 8:32156436-32156458 TAGAGTTTACACTCTGGTGAAGG - Intronic
1039274044 8:35915372-35915394 CAGGTTTAACTGTCTGATGAGGG + Intergenic
1039519550 8:38158738-38158760 AAGGGTTTACATTCTAGTGAGGG + Intergenic
1042025480 8:64418649-64418671 GAGGGTTTAGCTTCTGCTGAGGG + Intergenic
1042356492 8:67834062-67834084 CAGCCTTTCCATTCAGATGAGGG + Intergenic
1043195554 8:77287729-77287751 CAGGGTCTCCTTTCTGCTGAGGG + Intergenic
1043197521 8:77316485-77316507 GAGGGTTTAGTTTTTGATGAGGG - Intergenic
1045847443 8:106655201-106655223 CAAAGATTACATTTTGATGATGG + Intronic
1047232990 8:123013184-123013206 CTGGGTTTTCATTTTAATGAAGG - Exonic
1047812980 8:128430289-128430311 CAGGCTTTGCATTTTGATGGAGG + Intergenic
1048050917 8:130815190-130815212 AAGGGTTTGTTTTCTGATGAGGG - Intronic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1051251919 9:15168256-15168278 CACGGTTTACAGGCTCATGAGGG + Exonic
1051358409 9:16260982-16261004 TAGGATTTAAATTGTGATGAAGG + Intronic
1051500979 9:17777596-17777618 CATGTTTTAATTTCTGATGAGGG + Intronic
1055383452 9:75734683-75734705 CAGGGTTTATAATCTAATGTGGG - Intergenic
1057900271 9:98943276-98943298 TGGAGCTTACATTCTGATGAAGG + Intronic
1058590923 9:106564986-106565008 CAGGATTCACATGCTGATTACGG - Intergenic
1059976719 9:119725399-119725421 GGGGGTTTACACTCTAATGAAGG - Intergenic
1061190892 9:129081981-129082003 CAGTGCTTACCTTCTGGTGATGG + Intronic
1186916149 X:14223995-14224017 CTGAGTTGGCATTCTGATGATGG + Intergenic
1188880775 X:35489506-35489528 CAAGGTTTACATTTTTATGTTGG - Intergenic
1190297960 X:49039579-49039601 CAGGGGTCACAGTCTGATGGGGG + Intronic
1193091385 X:77496870-77496892 CAGGGCTTACATACTGGTAAAGG + Intergenic
1193206620 X:78755846-78755868 CAGGGACTCCATTCTGATGTGGG - Exonic
1193238161 X:79133941-79133963 CAGGGTTCATTTTCTGATGAGGG + Intergenic
1194656149 X:96576134-96576156 TGGGGCTTACATTCTAATGAGGG + Intergenic
1194801122 X:98274509-98274531 CAGGTTTTACATGGTGATGCAGG - Intergenic
1196596069 X:117546959-117546981 CAGGGCTTACAGTCTGATTGGGG + Intergenic
1197329761 X:125139144-125139166 CAGAGCTTACAATCTGATGGGGG + Intergenic
1197742990 X:129909976-129909998 TGGGGTTTACATTCTAATGAAGG + Intronic
1197780440 X:130153786-130153808 CAGGGTTCAGTTTCTGGTGAGGG - Intronic
1202298587 Y:23386326-23386348 TAGGGGTTACATTCTAATGGAGG - Intergenic
1202572221 Y:26284273-26284295 TAGGGGTTACATTCTAATGGAGG + Intergenic