ID: 1112421335

View in Genome Browser
Species Human (GRCh38)
Location 13:99252114-99252136
Sequence CTGGATGACCAGTTGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112421335_1112421339 20 Left 1112421335 13:99252114-99252136 CCACTTCCCAACTGGTCATCCAG 0: 1
1: 0
2: 2
3: 19
4: 226
Right 1112421339 13:99252157-99252179 TTTGCATTCTCATGCCTACTTGG 0: 1
1: 0
2: 1
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112421335 Original CRISPR CTGGATGACCAGTTGGGAAG TGG (reversed) Intronic
900744829 1:4353937-4353959 CTGAATGGCCAGTAGGGATGTGG + Intergenic
901455406 1:9360245-9360267 CTGGATGCCAAGTGAGGAAGGGG + Intronic
901678157 1:10898710-10898732 CTGGTTGGCCAGCTGGGAAGGGG - Intergenic
901810322 1:11763761-11763783 AAGGGTGACCAGTTGGGAGGTGG + Intronic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
902402657 1:16166592-16166614 CTGGATGAGGAGCTGGGGAGGGG + Intergenic
902651256 1:17839079-17839101 CTGGACAACCAGCTGGTAAGAGG - Intergenic
903181287 1:21606186-21606208 CCGGATGACCCGCTGTGAAGGGG + Exonic
904042916 1:27594465-27594487 CAGGATGACCAGGTGCCAAGGGG + Intronic
905545058 1:38791164-38791186 CTGGATGATCAGATTGTAAGGGG - Intergenic
905746982 1:40426492-40426514 CTGGTTGACCAGCTGGAAATTGG + Intergenic
906124624 1:43420130-43420152 CTGGAAGACCAGTGGAGATGGGG - Intronic
907338504 1:53716371-53716393 GTGGGTGACCAGTTGGGGAAAGG + Intronic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
908034232 1:60034634-60034656 CTGAATGAGGAGTTGGGAAGAGG + Intronic
912692559 1:111815389-111815411 ATGGAGGCCTAGTTGGGAAGAGG - Intronic
915120891 1:153629035-153629057 GTGGAGGTCGAGTTGGGAAGGGG - Intronic
916051832 1:161041835-161041857 CTGGATCACCGCCTGGGAAGGGG + Exonic
920189504 1:204184006-204184028 GTGTAAGACCAGGTGGGAAGGGG - Intergenic
920882810 1:209896162-209896184 GAGGAAGATCAGTTGGGAAGGGG - Intergenic
921572521 1:216796265-216796287 CTGGGAGCCCAGTGGGGAAGTGG - Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
921808395 1:219481642-219481664 CTGGATGACTTCTTGGCAAGAGG + Intergenic
923859583 1:237879776-237879798 CTGGAAGATCAGTTAGCAAGAGG + Intronic
923892964 1:238235951-238235973 CTGAATGAGCAGCTTGGAAGTGG + Intergenic
924032334 1:239898480-239898502 CTGGATTACAAATAGGGAAGAGG + Intronic
924105212 1:240642712-240642734 CTGGAGGATCAGTTGGGACCAGG - Intergenic
1065079255 10:22111407-22111429 CTGGAAGACGAGCTGGGGAGGGG + Intergenic
1066371583 10:34822234-34822256 CTGGAGAACCTATTGGGAAGAGG - Intergenic
1066402167 10:35087143-35087165 CCAGATGACCAGGTTGGAAGTGG - Intronic
1067242662 10:44509299-44509321 CTGGGTGACCTGGTGGGGAGGGG + Intergenic
1068365808 10:56048621-56048643 CTAGAGGACCATTTGGTAAGAGG + Intergenic
1069156293 10:65034808-65034830 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1070719324 10:78745401-78745423 CTGGAGGTCCACTTGGGAGGAGG - Intergenic
1072158184 10:92742900-92742922 CTGGATGTCCAGTAGGGGATGGG + Intergenic
1072451180 10:95540991-95541013 CTGGCTGACCAGCTTGGATGAGG - Intronic
1076883713 10:133251910-133251932 CAGGATGACCACCTGGGCAGGGG + Intergenic
1077405381 11:2380176-2380198 CAGGATGTGCAGTGGGGAAGGGG + Intronic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1081820428 11:45988659-45988681 CTGGATGACCACTTGAGACCAGG + Intronic
1085716384 11:78877353-78877375 CTGGAGGAGAAGTTAGGAAGGGG - Intronic
1086180598 11:83946411-83946433 CTGGATGTCCAGGGTGGAAGTGG - Intronic
1086647126 11:89236931-89236953 CTGAATGCCAAGTTGGGAAATGG - Intronic
1086887438 11:92222459-92222481 CTGGATGACCACTTGGGGTCAGG - Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1089205488 11:116758269-116758291 CTGTATGCCCAGTGGGGAAAAGG - Exonic
1089966963 11:122661324-122661346 CTGCATGAGGAGTTGAGAAGCGG + Intronic
1091988944 12:4938800-4938822 CTGGATGTGGAGGTGGGAAGGGG + Intergenic
1092165428 12:6339623-6339645 CTGGAGCACCAGTTGGGAGGAGG - Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1093691703 12:22116183-22116205 ATGGATGACGAGTTGGCAGGGGG + Intronic
1094263410 12:28527569-28527591 CTGGTTGACCTGCTGGGAAGTGG + Intronic
1097246145 12:57608843-57608865 ATGGCTGAACAGTTTGGAAGTGG - Intronic
1097414554 12:59298432-59298454 ATGGATGACAAGTTGGGCTGAGG + Intergenic
1097876446 12:64648271-64648293 CTGGACGATTAGTTGGGCAGTGG + Intronic
1099115303 12:78617114-78617136 GTGCAAGACCTGTTGGGAAGGGG - Intergenic
1102259846 12:111437199-111437221 ATGGATGAGCACTTGGGTAGGGG + Intronic
1103951576 12:124554384-124554406 CTGGATGCCCAGCTGGGTGGTGG - Intronic
1105428898 13:20319202-20319224 CTGGATGCCAAGTTGACAAGGGG + Intergenic
1105702570 13:22944224-22944246 CTGGAAGCCCAGTAGGGAAAGGG - Intergenic
1105981202 13:25518237-25518259 CTGAGTGACCATTTGGGAGGAGG + Intronic
1106057510 13:26252426-26252448 CTGGAGGAAAAGTTGTGAAGAGG - Intergenic
1106675239 13:31951383-31951405 CTGCGTGACCAGATGGGCAGGGG - Intergenic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1107710411 13:43145384-43145406 CTGGATGTGCTGTTGGGTAGGGG + Intergenic
1111117316 13:83796527-83796549 CTGAATGTCGAGTGGGGAAGAGG - Intergenic
1111966348 13:94865931-94865953 CTGTACAACCAGTTGGTAAGGGG + Intergenic
1112200499 13:97269478-97269500 CTGGATGAGCAGGGAGGAAGGGG - Intronic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1113281332 13:108791630-108791652 CTGGATGAGCAATAGAGAAGAGG - Intronic
1114043330 14:18700186-18700208 CTGGATGGACAGGTGGGATGCGG - Intergenic
1114064803 14:19052123-19052145 ATGGAAGACCAGTGGGGAGGAGG + Intergenic
1114097458 14:19347879-19347901 ATGGAAGACCAGTGGGGAGGAGG - Intergenic
1114975090 14:28085937-28085959 ATGGATGAGGAGTTGGGAAGTGG - Intergenic
1116862433 14:50005381-50005403 CTGGCTGACCAACTGGGAAGTGG - Intronic
1117095787 14:52296044-52296066 CTGGGTGACCAGATGGCAAAAGG - Intergenic
1117520872 14:56550215-56550237 CTGGATAAGTAGTTGGCAAGAGG - Intronic
1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG + Intergenic
1118439794 14:65801942-65801964 GTGCATGGCCAGCTGGGAAGTGG + Intergenic
1122503815 14:102219061-102219083 ACGGATGACCATTTGGGCAGTGG + Intronic
1122933594 14:104945842-104945864 CTGGACCTCCAGTTGGGCAGAGG + Exonic
1122933710 14:104946337-104946359 CTGGACCTCCAGTTGGGCAGAGG + Exonic
1122933942 14:104947327-104947349 CTGGACCTCCAGTTGGGCAGAGG + Exonic
1123955126 15:25327272-25327294 GTGGATGTCCCCTTGGGAAGCGG + Intergenic
1128847894 15:70917576-70917598 TGGGATGACCAGTTGCAAAGAGG + Intronic
1131085198 15:89570040-89570062 CTGGATGAGAGGTTGGAAAGAGG - Intergenic
1132414558 15:101611047-101611069 CTGGAGGAACAGTGGGGAGGAGG - Intergenic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1135008897 16:18855476-18855498 GTAGATGACCAGTTGGCAGGTGG - Intronic
1135588531 16:23689471-23689493 CTGGATGAAAAGTAGGTAAGGGG - Intronic
1135620360 16:23950314-23950336 CAGGAGCACCAGTTGGGGAGTGG - Intronic
1137539727 16:49353970-49353992 ATGAAAGACCAGCTGGGAAGGGG - Intergenic
1137916023 16:52431088-52431110 CTGGAGGAACAGCTTGGAAGGGG - Intergenic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1138339148 16:56277252-56277274 CTGGAGGCCAAGTTGGGAAGTGG + Intronic
1138630457 16:58290629-58290651 CTGGTTGAACAGTTGATAAGTGG + Intronic
1139625805 16:68187679-68187701 CAGGATGACCAGCTGTGGAGAGG - Intronic
1140531377 16:75669644-75669666 CTGGATTTCAACTTGGGAAGGGG - Intronic
1140720877 16:77770589-77770611 CTGGAAGATCATTTGGGAACTGG + Intergenic
1141954925 16:87364387-87364409 CTGGATGGCCAGGTGTGCAGTGG + Intronic
1142854422 17:2721957-2721979 CTGGATGCCCAGGAGGGAAGGGG + Intergenic
1143121560 17:4610839-4610861 TGGGATGACAAGCTGGGAAGGGG + Intergenic
1144799471 17:17915363-17915385 CTGGCTTACCAGGTGTGAAGTGG + Intronic
1146169485 17:30621688-30621710 CTGGGTGAGGAGTTGGGGAGCGG + Intergenic
1146170077 17:30625761-30625783 CTGGGTGAGGAGTTGGGGAGCGG - Intergenic
1146652259 17:34614016-34614038 CAGGATGACCACGAGGGAAGGGG - Intronic
1147615892 17:41827415-41827437 CTGAATGACAAGGTGGGTAGAGG - Exonic
1148241189 17:46000406-46000428 CTGGAGCACCAGCTGGGTAGGGG + Intronic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149990692 17:61381902-61381924 GAGGATGACCAGTTGGGGATAGG - Intronic
1150895556 17:69206530-69206552 CTGCCTGACAGGTTGGGAAGGGG - Intronic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151190641 17:72395400-72395422 CTCTATGCCCAGATGGGAAGAGG - Intergenic
1153671628 18:7417820-7417842 CTGCATGAACAGTTGGGTGGAGG - Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155387755 18:25299028-25299050 CTGGATTTCCACGTGGGAAGTGG - Intronic
1155394908 18:25376963-25376985 ATGGATGAGGAGCTGGGAAGGGG - Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1161998646 19:7730008-7730030 CTGGATGAGCAGGTGCGCAGGGG - Exonic
1162413433 19:10519601-10519623 CCAGCTGACCAGCTGGGAAGGGG - Intergenic
1162688021 19:12403999-12404021 CTGAATGACCAATTGGTCAGTGG - Intronic
1165326516 19:35117294-35117316 CTGGATGACATCATGGGAAGGGG + Exonic
1166381021 19:42355473-42355495 CAGGATGACCAGTAGGGGATGGG + Intronic
1166898166 19:46036884-46036906 CTGAATGACCAGCTGAGAAGAGG + Intergenic
1166986106 19:46660808-46660830 CTGGAGGAGCAGCTGGTAAGGGG - Exonic
1167154183 19:47728322-47728344 GTGGATGGCCAGGTGGGAGGGGG - Intronic
929949421 2:46395045-46395067 CAGGATGACCAGAGGGGAACTGG + Intergenic
930023845 2:47017804-47017826 CTACATGACAAATTGGGAAGTGG - Intronic
930957289 2:57217698-57217720 CAGGATGACCAGCTGTGGAGAGG + Intergenic
931666366 2:64612209-64612231 CTGGGGGACCAGTTGGGTGGGGG + Intergenic
931985034 2:67733449-67733471 CTGGAGGACTAGTGGGGAAGAGG - Intergenic
932803566 2:74764222-74764244 CTGGAAGATCAGGTGGGGAGAGG + Intergenic
935127865 2:100239926-100239948 CTGCCTGTCCAGGTGGGAAGAGG + Intergenic
937301013 2:120841803-120841825 CTGGTTCCCCAGTTGGGAGGAGG + Intronic
937357501 2:121207261-121207283 CTGAATGACCATGTGGGAGGCGG + Intergenic
938424992 2:131179150-131179172 CTGGATGGACAGGTGGGATGCGG - Intronic
938482078 2:131671151-131671173 ATGGAAGACCAGTAGGGAGGAGG + Intergenic
939720659 2:145646338-145646360 ATGGATGCCAAGTTGGCAAGGGG - Intergenic
939726744 2:145729985-145730007 CAGGATGACCATATGGTAAGGGG + Intergenic
940890765 2:159033294-159033316 GTGAATCACCAGTTAGGAAGTGG + Intronic
943426968 2:187749729-187749751 CAGGATGACCAGATGTGGAGAGG - Intergenic
944271010 2:197785539-197785561 CTCGCTGACCAGTCGGGGAGTGG + Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
947906503 2:233767280-233767302 TTGGATTAATAGTTGGGAAGTGG - Intronic
948254330 2:236554949-236554971 CTGAATGTCAAGTTTGGAAGGGG + Intergenic
948486881 2:238287122-238287144 CTGGAGTGCCAGGTGGGAAGGGG - Intronic
948663485 2:239520712-239520734 CTGGCTGGGCAGCTGGGAAGGGG + Intergenic
1169055250 20:2615466-2615488 CTGGAAGACAAATTGGGATGTGG + Intronic
1171112775 20:22499817-22499839 CTAGAAGACCAGCTGGGAGGGGG - Intergenic
1172558177 20:35861551-35861573 CTTAATGACCATTTGGGAATTGG - Intronic
1174273548 20:49386975-49386997 CTGGCTGGCCTGTTAGGAAGAGG - Intronic
1174761416 20:53210405-53210427 CTGGATGAGGAGTTGGGAGGGGG + Intronic
1176446814 21:6828807-6828829 ATGGAAGACCAGTGGGGAGGAGG + Intergenic
1176824985 21:13693833-13693855 ATGGAAGACCAGTGGGGAGGAGG + Intergenic
1180466152 22:15613303-15613325 CTGGATGGACAGGTGGGATGCGG - Intergenic
1180483291 22:15774745-15774767 ATGGAAGACCAGTGGGGAGGAGG + Intergenic
1180995774 22:19964508-19964530 CTGGGTGGCCTGTTGGGAACTGG + Intronic
1181760317 22:25053761-25053783 TTGGAGGACCAGTTGGGCTGAGG + Intronic
1181937482 22:26449207-26449229 ATGGTTGTCCAGGTGGGAAGTGG - Intronic
1183709161 22:39492318-39492340 CTGGATGGCCAGTGGGGAGAGGG + Intergenic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184424588 22:44402110-44402132 GTGCAGGTCCAGTTGGGAAGAGG + Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
950528465 3:13538818-13538840 GTGAATGACAAGTTGGGAAAGGG - Intergenic
953563997 3:44015476-44015498 CTGGAGGCCCAGCTGGGAGGAGG - Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959213036 3:103413380-103413402 ATGGATGCCAAGTTGGCAAGAGG - Intergenic
960372684 3:116860327-116860349 CTGGATGTCCATATGGAAAGAGG - Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
962290228 3:134129631-134129653 GTGGATGCCTAGTTGAGAAGAGG - Intronic
963030127 3:140962144-140962166 CTTGATGCCAAGTTGGGAAGAGG - Intronic
963625699 3:147669890-147669912 CTGGATAACAAGATGTGAAGAGG - Intergenic
968731607 4:2271772-2271794 CTGGGTGACTAGTGGAGAAGGGG + Exonic
969549263 4:7853508-7853530 CTGGATGAGGACTGGGGAAGAGG - Intronic
974974665 4:68875207-68875229 CTGGATGACCAGAGGCTAAGTGG + Intergenic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
976829913 4:89304045-89304067 CTGGATGTGCAGTGAGGAAGGGG - Intronic
983413397 4:167425310-167425332 CTGGGGTACCAGTTGGGAAGGGG - Intergenic
985525875 5:401399-401421 CTGCATCACCACTTGCGAAGGGG + Intronic
988261640 5:28894020-28894042 ATGGATGACTAATTGGAAAGGGG + Intergenic
990967547 5:61465250-61465272 CTGGGTGGGCAGTTGGGGAGGGG - Intronic
992080646 5:73232673-73232695 CTGGAGGAAGAGTGGGGAAGCGG - Intergenic
994097352 5:95858954-95858976 GTTGATGAGCAGTCGGGAAGTGG + Exonic
997416777 5:133735042-133735064 CTGCAAGGCCTGTTGGGAAGAGG - Intergenic
997986466 5:138505222-138505244 CTCAATTACCAGCTGGGAAGGGG - Intergenic
998402103 5:141853408-141853430 CTGCATGACCAGCAGGGAATGGG + Exonic
1001917099 5:175570914-175570936 CTGGATGACCAGTTTAGAAGTGG + Intergenic
1002091133 5:176807198-176807220 TAGGATGGCCAGATGGGAAGAGG - Intergenic
1004450727 6:15743280-15743302 GTTGAGGACTAGTTGGGAAGAGG - Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1006435663 6:34024927-34024949 CTGGATGACCAAGAGGGCAGAGG + Intronic
1007979983 6:46143056-46143078 GGGTATGACCAGTTGGGAAAAGG + Intronic
1009530177 6:64803311-64803333 CTGGATGACCAGCTGTGGAAAGG - Intronic
1009822279 6:68818417-68818439 CTGGATGGAGGGTTGGGAAGGGG - Intronic
1011718475 6:90131103-90131125 CTGGAGGACCACTGGGGAAAAGG + Intronic
1013403014 6:109817035-109817057 ATGGATGACCAGTTGTGCAGAGG + Intronic
1014187616 6:118453811-118453833 CTGGATGGCCAGTTCTTAAGTGG + Intergenic
1016184010 6:141178653-141178675 CTTGCTGACCAGTAGGGAATTGG - Intergenic
1016758831 6:147715846-147715868 ATGGATGACCAGCTGTGGAGAGG - Intronic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1020074004 7:5245794-5245816 CTGGGTGACAACCTGGGAAGTGG - Intergenic
1020254529 7:6495410-6495432 CTGGATGACCTCTTGGCCAGGGG - Intergenic
1020460582 7:8425606-8425628 CTGGAAAACTAGTTGGGAACTGG + Intergenic
1022031413 7:26494562-26494584 ATTGATGACCATTTGGGGAGTGG - Intergenic
1022664637 7:32399128-32399150 CTGGATGAGGAGCTGGGAAGAGG + Intergenic
1024050295 7:45616935-45616957 CTGGATCTCCAGTGGGAAAGTGG - Intronic
1026156181 7:67827716-67827738 CTGAATGATCTGTTGGGAACTGG + Intergenic
1026482405 7:70790232-70790254 CTGGACGAGGAGTTGGGAGGCGG - Exonic
1030570325 7:111213722-111213744 CAGTATGACCAGTTGTGGAGAGG + Intronic
1031178517 7:118383984-118384006 TTGGTTTACCAGTTGGGAATGGG + Intergenic
1031786618 7:126041139-126041161 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1032298283 7:130662573-130662595 CTGGATGTGGAGTGGGGAAGGGG - Intronic
1033969233 7:147018471-147018493 CTGGATGACTGGTTTGGATGGGG + Intronic
1034285530 7:149881074-149881096 CTGCAGGTCCAGTGGGGAAGTGG + Intergenic
1035101521 7:156401591-156401613 CTGGATATCCTTTTGGGAAGAGG + Intergenic
1036693195 8:10957682-10957704 CTGGATGGCCAGGAGGGATGGGG - Intronic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1037809737 8:22080449-22080471 CTGGAAGCCCAGGTGAGAAGTGG + Exonic
1043403687 8:79908961-79908983 CTGGATGACCACTTGAGAAGAGG - Intergenic
1045036170 8:98178196-98178218 CTGCATGAGCAGATGGGAACTGG - Intergenic
1048070226 8:131013183-131013205 CAGGATGTCCCATTGGGAAGGGG - Intronic
1048270349 8:133023182-133023204 CTGGATGACCACATGGCATGAGG + Intronic
1048400610 8:134065427-134065449 CCTGCTGACCAGTTGAGAAGTGG - Intergenic
1048865050 8:138754659-138754681 GTAAATCACCAGTTGGGAAGCGG - Intronic
1049609089 8:143544585-143544607 CTTGATGAGCAGTTGTGCAGTGG + Intergenic
1052074487 9:24123876-24123898 CTCCAAGACCATTTGGGAAGAGG - Intergenic
1052652358 9:31321212-31321234 CAGGATGACCAGTTGTAGAGAGG - Intergenic
1057157231 9:92853727-92853749 CAGTATAACCAGTTGGGAAGAGG + Intronic
1058864568 9:109149694-109149716 CAGGAGGAGCAGTAGGGAAGGGG + Exonic
1059903353 9:118953548-118953570 ATGGATCACCATTTGGGAAGTGG + Intergenic
1059959226 9:119548995-119549017 CTGGAGCCTCAGTTGGGAAGAGG - Intergenic
1060220750 9:121762899-121762921 CTGGATTGCCAGGTGGGCAGTGG + Intronic
1060470917 9:123947505-123947527 ATGGAGCACCAGGTGGGAAGTGG + Intergenic
1061323890 9:129850546-129850568 CTGGCTGACCATTTGGGACAGGG + Intronic
1061805000 9:133132963-133132985 GTGGGGGACCAGTAGGGAAGTGG + Intronic
1061912276 9:133731542-133731564 GTGGATGCCCAGTTGGGGAGGGG - Intronic
1203522378 Un_GL000213v1:55724-55746 ATGGAAGACCAGTGGGGAGGAGG - Intergenic
1187731397 X:22258878-22258900 CATGAAGACCAGTTAGGAAGTGG + Intergenic
1190087582 X:47409241-47409263 CTGCATGAACAGCTGGGATGAGG - Intronic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1192144326 X:68670991-68671013 CAGGAAGACCAGTTAGGTAGCGG - Intronic
1192658855 X:73021685-73021707 CTGGCTGCCCATCTGGGAAGTGG - Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1197100970 X:122654705-122654727 CTGGATGACCAGTGGGTCAATGG + Intergenic
1197378446 X:125710117-125710139 ATGGATGACCAGCTGTGGAGAGG + Intergenic
1198026223 X:132710141-132710163 CTGGGAGCCCAGGTGGGAAGAGG + Intronic
1199672767 X:150160796-150160818 CTGCATGACCCCTGGGGAAGTGG + Intergenic