ID: 1112423193

View in Genome Browser
Species Human (GRCh38)
Location 13:99272444-99272466
Sequence GACCCTACATTCCTGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112423193_1112423198 27 Left 1112423193 13:99272444-99272466 CCCAGGAGCAGGAATGTAGGGTC 0: 1
1: 0
2: 1
3: 31
4: 281
Right 1112423198 13:99272494-99272516 TCGTGCTGTCATAGAGTGGGTGG 0: 1
1: 0
2: 1
3: 2
4: 75
1112423193_1112423197 24 Left 1112423193 13:99272444-99272466 CCCAGGAGCAGGAATGTAGGGTC 0: 1
1: 0
2: 1
3: 31
4: 281
Right 1112423197 13:99272491-99272513 AACTCGTGCTGTCATAGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1112423193_1112423196 23 Left 1112423193 13:99272444-99272466 CCCAGGAGCAGGAATGTAGGGTC 0: 1
1: 0
2: 1
3: 31
4: 281
Right 1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112423193 Original CRISPR GACCCTACATTCCTGCTCCT GGG (reversed) Intronic
901167983 1:7233391-7233413 GACCAGCCATTCCTGCTGCTTGG - Intronic
901450627 1:9334657-9334679 GACCCCCCATTCCTGCTCCCCGG + Intronic
901450639 1:9334693-9334715 GACCCCCCATTCCTGCTCCCCGG + Intronic
901590537 1:10337784-10337806 GACCCTACATTCCTGGTAAAGGG - Intronic
901676094 1:10886243-10886265 GACCCAACAATTCTACTCCTAGG + Intergenic
904537969 1:31213551-31213573 GGCCCTGCATTTCTTCTCCTAGG + Intronic
905056959 1:35103671-35103693 GACCCTGCAATCCCACTCCTTGG - Intronic
905752050 1:40474133-40474155 GACCCAGCAATCCTGCCCCTGGG - Intergenic
907604211 1:55800537-55800559 GACCCAGCAATCCTGCTACTGGG + Intergenic
907775872 1:57514199-57514221 GACCCAGCAATCCTGCTACTGGG - Intronic
908012240 1:59790460-59790482 GACCCAACAATGCTACTCCTAGG - Intergenic
910138656 1:84001092-84001114 GACCCAATGCTCCTGCTCCTCGG - Intergenic
911405432 1:97432217-97432239 GACCCAGCAGTCCTGCTGCTGGG - Intronic
912910264 1:113751743-113751765 GACCCAACATTTCCACTCCTAGG - Intronic
914431500 1:147623974-147623996 GACCCAACATACCTCCTCATGGG + Exonic
914914174 1:151808152-151808174 CACCCTAGATTTCAGCTCCTTGG + Intronic
915446135 1:155976057-155976079 AAACTTACATTCCTCCTCCTAGG + Intronic
915678303 1:157552625-157552647 GACCCTACATTTTTGCTATTGGG + Intergenic
916714362 1:167436954-167436976 GACCCAACAATCCCGCTTCTGGG + Intronic
917289117 1:173454082-173454104 AAGCCCACATTCCTTCTCCTTGG + Intergenic
918280204 1:182996830-182996852 GACCCAACAATCCTGTTACTGGG - Intergenic
919556490 1:199061445-199061467 GACCCAGCAATCATGCTCCTTGG + Intergenic
920897123 1:210064778-210064800 GACCCTACAATTCTATTCCTAGG - Intronic
922296000 1:224250288-224250310 GACCCTGCAATCCTGCGCCCGGG - Exonic
923263926 1:232294355-232294377 GACCCTGCAATCCTACTACTGGG - Intergenic
923461434 1:234212945-234212967 GACCCTATATACCTTTTCCTTGG + Intronic
924149877 1:241118520-241118542 GACCCTGCAATCCTACTACTGGG + Intronic
924458325 1:244236088-244236110 TACCTTACTTTCCTTCTCCTTGG - Intergenic
924646030 1:245878012-245878034 GTCCCTTCCTTCCTCCTCCTGGG - Intronic
1064616455 10:17163284-17163306 GATCCTCTATTCCTGCTGCTCGG - Intronic
1065277861 10:24104140-24104162 GATCCAACAATCATGCTCCTTGG + Intronic
1065736232 10:28755143-28755165 CATCCTTCACTCCTGCTCCTAGG - Intergenic
1067910354 10:50340188-50340210 AACTCTAGAGTCCTGCTCCTTGG + Intronic
1068746944 10:60543286-60543308 GCCCCTAGATTCCTGTTTCTAGG + Intronic
1069637085 10:69931388-69931410 GACCCTCCCTGCCTGCTCCCAGG - Intronic
1070070760 10:73087000-73087022 GACCCAACATTCCCGCTCCTAGG - Intronic
1070410154 10:76132246-76132268 CACCCTGCCTTCCTGCTTCTTGG - Intronic
1070896124 10:79983817-79983839 GACCATACATACCTGCCCGTGGG + Intergenic
1072176758 10:92931911-92931933 GACCTAGCAGTCCTGCTCCTAGG + Intronic
1073228924 10:101950426-101950448 GACCCAGCAATTCTGCTCCTAGG + Intronic
1073372457 10:103002880-103002902 GACCCTGCAATTCTGCTACTAGG + Intronic
1074481378 10:113824669-113824691 GACCCAGCAATCCTACTCCTAGG + Intergenic
1075942452 10:126403200-126403222 GACCCAGCAATCCCGCTCCTGGG - Intergenic
1078394803 11:10971709-10971731 GACCCTTCACTCTTGGTCCTAGG - Intergenic
1078783395 11:14462198-14462220 GAGCCTACATTCCTCTTTCTAGG + Intronic
1080184672 11:29467503-29467525 CACCCAGCAATCCTGCTCCTAGG + Intergenic
1080269678 11:30437820-30437842 CCCCCGAGATTCCTGCTCCTTGG - Intronic
1081272621 11:41104590-41104612 GACCCAGCAGTTCTGCTCCTAGG + Intronic
1081551434 11:44116521-44116543 GACCCAGCAGTTCTGCTCCTAGG - Intronic
1081913918 11:46719041-46719063 GACCATCCATCCCTGCTCCCAGG + Intergenic
1083287786 11:61671574-61671596 GACCCAGCAATCCTACTCCTAGG + Intergenic
1084340441 11:68495846-68495868 GACCCAACAATTCTACTCCTAGG - Intronic
1084895945 11:72268382-72268404 GATCCTTCAGTTCTGCTCCTTGG - Intergenic
1084896531 11:72275069-72275091 GACCCAACAATTCTACTCCTAGG - Intergenic
1089633555 11:119797958-119797980 GGCCCTACTTTCCTGTTCCAGGG + Intergenic
1091815794 12:3436863-3436885 GGCTCTGCATTCCTGCTTCTGGG + Intronic
1091974933 12:4816894-4816916 GACCCTCCCTTCCCTCTCCTTGG + Intronic
1092059967 12:5540576-5540598 GACCCAACAATCCCACTCCTGGG - Intronic
1092728686 12:11508495-11508517 TAGCCCACATTCCTGCTCCTGGG - Intergenic
1094468582 12:30780953-30780975 GACCCAGCATTTCTACTCCTAGG + Intergenic
1094478677 12:30862645-30862667 GGCTCTGCATTCCTGCTTCTGGG - Intergenic
1097172227 12:57122599-57122621 GATCCTACATTCCTGGGTCTGGG + Intronic
1098350852 12:69558486-69558508 CACCCTACATTCCAGCTCTAAGG + Intronic
1098905836 12:76161551-76161573 GACCCTGCAGTTCTACTCCTAGG - Intergenic
1099248587 12:80223443-80223465 GACCCAGCAATCCTACTCCTAGG - Intronic
1099716868 12:86306186-86306208 GACCCTACAGTTCCACTCCTAGG + Intronic
1099934888 12:89113170-89113192 GATCCAACAGTTCTGCTCCTGGG - Intergenic
1099940386 12:89180854-89180876 GATCCAGCAATCCTGCTCCTTGG + Intergenic
1100625816 12:96330863-96330885 GACCCAACAATTCTGTTCCTAGG - Intronic
1101776254 12:107796913-107796935 GACCCAGCAATCCCGCTCCTAGG + Intergenic
1102189445 12:110975581-110975603 GACCCAGCATTTCTACTCCTGGG + Intergenic
1102760425 12:115380331-115380353 GACCTTTCATTTCTGCTCTTTGG + Intergenic
1103075335 12:117977759-117977781 GACCCTTCAATTCTGCTCCTGGG - Intergenic
1103934920 12:124470331-124470353 GACCCAGCAATTCTGCTCCTAGG + Intronic
1105279276 13:18953885-18953907 GACCCTGCAGACCTGCCCCTTGG + Intergenic
1108381158 13:49855715-49855737 GACCCAACAATTCTACTCCTAGG + Intergenic
1108548155 13:51517097-51517119 GACCTAGCAATCCTGCTCCTAGG + Intergenic
1109195449 13:59373342-59373364 CAGCCTATATTCCTGCTCCAGGG - Intergenic
1111872842 13:93855542-93855564 TATCCTGCATTCTTGCTCCTTGG - Intronic
1112339252 13:98538829-98538851 GTCCCTTCTTTCTTGCTCCTCGG + Intronic
1112423193 13:99272444-99272466 GACCCTACATTCCTGCTCCTGGG - Intronic
1112677711 13:101722749-101722771 CACCAGACATTCCTGCTCCGTGG - Exonic
1113367946 13:109695301-109695323 GACTCAACAATTCTGCTCCTGGG + Intergenic
1113452089 13:110417915-110417937 GACCCAACAATCCCACTCCTAGG - Intronic
1113718775 13:112535303-112535325 GACCCAACAGTTCTACTCCTAGG - Intronic
1114185864 14:20401709-20401731 TACCCTCTATTCCTGCTCCTTGG - Intronic
1115103265 14:29728791-29728813 GACCCAACAATGCTGCTTCTGGG - Intronic
1116492566 14:45523274-45523296 GACCCTACAATCCCTCTGCTGGG - Intergenic
1117637630 14:57762153-57762175 GTGCCTGCATTCCTGCTGCTAGG + Intronic
1118928704 14:70219359-70219381 GACCCAGCAATTCTGCTCCTAGG - Intergenic
1119215877 14:72868689-72868711 GACACTCCCTGCCTGCTCCTTGG - Intronic
1119221498 14:72911768-72911790 GACCCCAGAATCCTACTCCTAGG - Intergenic
1122430836 14:101641662-101641684 GACCCAACAATTCTGCTCCTAGG + Intergenic
1124417298 15:29482854-29482876 GAGCCTACAGTCATACTCCTTGG - Intronic
1126424773 15:48515445-48515467 GACGCTGCATTCCAACTCCTGGG - Exonic
1127174933 15:56344144-56344166 GACCCAGCAATTCTGCTCCTAGG + Intronic
1127198016 15:56611391-56611413 GACCCAGCAATCCTACTCCTGGG + Intergenic
1127630992 15:60827615-60827637 GACCCCAGATTCCTGCTGCTGGG + Intronic
1127721752 15:61708758-61708780 TACTCTACATTCTTGCTCTTAGG - Intergenic
1128424849 15:67531397-67531419 GACCCAGCAATTCTGCTCCTAGG + Intergenic
1128956939 15:71957101-71957123 GACCCACCAATTCTGCTCCTAGG - Intronic
1129355724 15:74989907-74989929 GACCCTGCAATTCTACTCCTAGG - Intronic
1130292840 15:82619895-82619917 GACCCAACAATCCCTCTCCTAGG + Intronic
1131817101 15:96233378-96233400 GACCCAGCTGTCCTGCTCCTGGG - Intergenic
1132289777 15:100691560-100691582 GATGCTACATTCCTGGACCTGGG - Intergenic
1132464673 16:72150-72172 GACTCTAGACTCCCGCTCCTGGG + Intronic
1132952685 16:2573058-2573080 GACCCTGCAGTCCCACTCCTAGG + Intronic
1132961666 16:2627112-2627134 GACCCTGCAGTCCCACTCCTAGG - Intergenic
1133602531 16:7353436-7353458 GACCCAGCAATTCTGCTCCTAGG + Intronic
1134024463 16:10943340-10943362 GATCCTACATTTCTGAGCCTGGG + Intergenic
1134433291 16:14232063-14232085 GATACTACATCCATGCTCCTGGG + Intronic
1135596864 16:23751267-23751289 GACCCAGCAATTCTGCTCCTAGG - Intergenic
1137657578 16:50173422-50173444 GATCCAACAATCGTGCTCCTTGG - Intronic
1138466189 16:57192840-57192862 GACCCTATAGTCCAGCTACTGGG - Intronic
1138971949 16:62155648-62155670 GACTCAACAATCCTGCTCTTAGG + Intergenic
1140157622 16:72449096-72449118 GATCCAGCAATCCTGCTCCTAGG - Intergenic
1141472402 16:84247965-84247987 GACTCAACAATTCTGCTCCTAGG + Intergenic
1141572673 16:84943546-84943568 GACCCTACAATGCTGCTCCCAGG - Intergenic
1141614831 16:85204472-85204494 GACCCAGCATTTCTGCTCCTAGG - Intergenic
1142360713 16:89625279-89625301 GACCCTATTCTCCTGCTCCCAGG + Intronic
1142555227 17:770976-770998 GACCCTGCAATTCTACTCCTAGG - Intronic
1143663672 17:8343512-8343534 GACCCTACAATGCTTCTTCTTGG - Intronic
1143919948 17:10323180-10323202 GACCCAGCAATTCTGCTCCTGGG - Intronic
1144669206 17:17122852-17122874 GACCCAGCACTTCTGCTCCTAGG + Intronic
1144940526 17:18936613-18936635 GACCCAGCAATTCTGCTCCTGGG + Intergenic
1147958496 17:44151446-44151468 GACCCTGCTTCCCTTCTCCTTGG + Intronic
1148039283 17:44693564-44693586 GACCCAGCATTTCTGCTTCTGGG + Intergenic
1150808064 17:68334853-68334875 GACCCTACATGCCAGTTTCTGGG - Intronic
1151472633 17:74327364-74327386 GACCCTTCATCCCTGCTCCCCGG - Intronic
1152207623 17:78982930-78982952 GACCCAGTAATCCTGCTCCTAGG - Intergenic
1153101882 18:1481043-1481065 GAACCTACAATCCTCCTGCTGGG + Intergenic
1153184302 18:2469909-2469931 GATCCTACAATCCTGCTTCGAGG - Intergenic
1156405823 18:36781665-36781687 GACTCTGCATTCCTGAACCTGGG + Intronic
1157225149 18:45856027-45856049 GACCCAGCAATTCTGCTCCTAGG + Intronic
1158163785 18:54516607-54516629 GACCCAGCAATTCTGCTCCTAGG - Intergenic
1159825449 18:73203112-73203134 GGCCCAGCAATCCTGCTCCTGGG - Intronic
1159845860 18:73459245-73459267 CACCCTGCATTCCTTCTTCTTGG - Intergenic
1160823221 19:1067735-1067757 CACCCTCCCTTCCTGCTCCCTGG - Intronic
1162800472 19:13107633-13107655 CACCGGACATTCCTTCTCCTGGG + Exonic
1163172163 19:15539548-15539570 GACCCAGCAATTCTGCTCCTAGG - Intronic
1164512341 19:28907832-28907854 GACTCTACATCTCTCCTCCTGGG + Intergenic
1164772747 19:30824003-30824025 GACTCAACATTTCTACTCCTTGG + Intergenic
1164909193 19:31992044-31992066 TTCCCAACATTCCTGCTCCCTGG - Intergenic
1165984239 19:39753648-39753670 GACCCAACAATCCTGCTACTGGG + Intergenic
1167569767 19:50279852-50279874 GACCCAACAATCCCGCTCCTAGG - Intronic
925724084 2:6856142-6856164 GCCCCTGCAGTTCTGCTCCTGGG + Intronic
926043664 2:9693997-9694019 CACCTTTCATTCCTGCTTCTCGG - Intergenic
926267037 2:11332719-11332741 GACCCTGCAGTCCCACTCCTTGG + Intronic
927355755 2:22171314-22171336 GATCCAACATTCCTACTCCTGGG + Intergenic
930049304 2:47202097-47202119 GACCCAACAATTCTACTCCTGGG + Intergenic
933148726 2:78889192-78889214 GCCCCTACTTGCCTGCTACTTGG - Intergenic
933706991 2:85298772-85298794 TTCCCTACATTCCTAGTCCTCGG + Intronic
933929326 2:87132515-87132537 GACCCATCAATCCTACTCCTAGG - Intergenic
934000654 2:87708307-87708329 GACCCATCAATCCTACTCCTAGG - Intergenic
934651664 2:96095277-96095299 GACCCAGCATTTCCGCTCCTAGG + Intergenic
935477987 2:103548911-103548933 GACCCTGCAATCCTATTCCTGGG - Intergenic
937171424 2:119874303-119874325 GACCCAACAATACTACTCCTAGG + Intronic
938034117 2:128021657-128021679 GACCCAACCATTCTGCTCCTTGG - Intronic
938249513 2:129803442-129803464 GACCCAGCAATCCTACTCCTAGG + Intergenic
938983463 2:136549079-136549101 GACCCAACAATTCTACTCCTAGG - Intergenic
940481491 2:154238015-154238037 GTGCCAACATTCCTGGTCCTTGG - Intronic
941610150 2:167651811-167651833 GACCCTAGAGTTCTGCTCCCTGG + Intergenic
941671942 2:168303455-168303477 GACCCAGCAATCCTGCTGCTGGG - Intergenic
941906268 2:170717571-170717593 AACCCTACCTCCCCGCTCCTGGG - Exonic
941923451 2:170873694-170873716 TACCCTAGATTCCAGATCCTTGG - Intergenic
942009140 2:171741296-171741318 GACCCAACAATCCCACTCCTAGG - Intronic
942191278 2:173473104-173473126 GACAGTTCATCCCTGCTCCTTGG + Intergenic
942921759 2:181382872-181382894 GCCCATACATTCCTCCTACTTGG + Intergenic
947210647 2:227705509-227705531 GACCCATCATTCCTGTTACTGGG - Intronic
947241650 2:228000901-228000923 GACCCAGCAATCCTGTTCCTTGG - Intronic
948631213 2:239303869-239303891 GACCCTACAGGCCTGCCCCGTGG + Intronic
1169539250 20:6581435-6581457 GACCCAACATCCCTCCTTCTTGG - Intergenic
1169990336 20:11496314-11496336 GGCTCAGCATTCCTGCTCCTTGG + Intergenic
1170670071 20:18424690-18424712 GACCCAGCAATCCTACTCCTAGG + Intronic
1171330668 20:24335776-24335798 GACCCAACAATCCTACTACTTGG - Intergenic
1173022331 20:39277329-39277351 GACTCCACATTCCTGCTCACAGG - Intergenic
1173578263 20:44127320-44127342 GACCCAGCAATTCTGCTCCTAGG - Intronic
1173616857 20:44408918-44408940 GGTCCTACGTTCCTGCTTCTGGG - Intronic
1174263780 20:49317043-49317065 GATCCAATATTCATGCTCCTTGG - Intergenic
1174388885 20:50204944-50204966 GACTCTGCAATCCCGCTCCTGGG - Intergenic
1176058008 20:63158921-63158943 GACCCAGCAATTCTGCTCCTAGG + Intergenic
1176412413 21:6456254-6456276 GACCTTACAGCCCGGCTCCTGGG + Intergenic
1177788627 21:25697776-25697798 GAGCCTATATTCCAGCTACTGGG + Intronic
1178709345 21:34901098-34901120 CTCCCCACATTCCCGCTCCTTGG - Intronic
1178880852 21:36449009-36449031 GACCCCACAATTCTACTCCTAGG - Intergenic
1179687907 21:43064576-43064598 GACCTTACAGCCCGGCTCCTGGG + Intronic
1179994854 21:44969291-44969313 GACCGAACATTCCTGGTTCTTGG + Intronic
1180029457 21:45194932-45194954 TACCCAGCATTCGTGCTCCTTGG - Intronic
1180164421 21:46015550-46015572 GACCCAACATTTGTACTCCTGGG - Intergenic
1180802156 22:18636963-18636985 GTTGCTACAGTCCTGCTCCTGGG + Intergenic
1180853394 22:19032515-19032537 GTTGCTACAGTCCTGCTCCTGGG + Intergenic
1181219567 22:21358296-21358318 GTTGCTACAGTCCTGCTCCTGGG - Intergenic
1181378365 22:22478909-22478931 GACCCCAAATTCCTGACCCTCGG + Intergenic
1182872568 22:33661644-33661666 CCCCATTCATTCCTGCTCCTTGG + Intronic
1182959129 22:34455561-34455583 TACCCTACATCCCTGGACCTGGG + Intergenic
1183110800 22:35647074-35647096 AACCCCTCATTCCTGCTCGTAGG + Intergenic
1184390701 22:44201506-44201528 GACCCAACATCCCAGCTCTTGGG - Intronic
1185311503 22:50158241-50158263 GTCCCTGCAGCCCTGCTCCTTGG + Intronic
949597158 3:5560057-5560079 GACCCAAAACTCTTGCTCCTGGG - Intergenic
950208657 3:11100137-11100159 GACCCAACAATTCTGCTCCTAGG - Intergenic
950321812 3:12062710-12062732 GATCCAGCATTCATGCTCCTAGG + Intronic
954413925 3:50383707-50383729 GACACTACCCTCCTTCTCCTGGG - Intronic
954760924 3:52873195-52873217 GACACCACAGCCCTGCTCCTGGG - Intronic
954817792 3:53296897-53296919 GACCCAGCAATTCTGCTCCTGGG - Intronic
954893131 3:53950524-53950546 GACACTACAATTCTACTCCTAGG + Intergenic
955622854 3:60884340-60884362 GACCCAGCAATCCTGCTGCTGGG + Intronic
955928298 3:64029656-64029678 GACCCAGCAATCCTGCTTCTGGG + Intergenic
955933763 3:64082880-64082902 TCCCCCACATCCCTGCTCCTTGG + Intergenic
958057769 3:88435028-88435050 GACCCTAGATTTGTCCTCCTAGG - Intergenic
958533657 3:95367167-95367189 GACCCAACAATCATGCTTCTTGG - Intergenic
961467596 3:127091028-127091050 GGCCCATCCTTCCTGCTCCTTGG + Intergenic
961931049 3:130533005-130533027 GAGCCTACATGCCAGCTCCAAGG + Intergenic
962168240 3:133073674-133073696 GATCCTACAATCCTACTACTGGG - Intronic
962473744 3:135737641-135737663 GACCCTACAATCATGCTCCCAGG - Intergenic
962507051 3:136057925-136057947 GATCCTACAGTCCTACTACTGGG + Intronic
966608025 3:181841641-181841663 GACCCAGCAATCTTGCTCCTTGG + Intergenic
967748985 3:193092382-193092404 GACCCAACAATCCTACTACTAGG + Intergenic
968636082 4:1680452-1680474 GATCCAGCAATCCTGCTCCTTGG + Intronic
969641959 4:8404202-8404224 GACCCTCCATACCTGCTACACGG + Intronic
970590176 4:17553192-17553214 GACCCAGCATTTATGCTCCTGGG + Intergenic
972025249 4:34367961-34367983 GACCCAACAATTCTACTCCTTGG + Intergenic
976137960 4:81959587-81959609 GACCCTGCATCCCTGCCCCTCGG + Intronic
978963199 4:114709466-114709488 GACCCCACAATCCTGTTACTGGG + Intergenic
982123095 4:152160878-152160900 GGTCCTACACTCCTGCCCCTCGG - Intergenic
982999519 4:162396453-162396475 AACCCAACAATCCTGCCCCTGGG + Intergenic
983929770 4:173440681-173440703 GAGCATACATTTCTGCTACTTGG - Intergenic
985633972 5:1027072-1027094 GGCCCTTCTTTCCAGCTCCTGGG + Intronic
986111649 5:4724976-4724998 GAGCCTCCATTCATGCTCCTTGG + Intergenic
986143260 5:5051406-5051428 GACCCTAGATTCCCTCTGCTGGG + Intergenic
989546053 5:42674862-42674884 GACCCTGCAATTCTGCTCCTAGG - Intronic
991298976 5:65109342-65109364 GACCCAGCAATTCTGCTCCTAGG - Intergenic
991683884 5:69164577-69164599 GATCCAACAGTCTTGCTCCTTGG + Intergenic
993608874 5:90030559-90030581 GACCCAACAATTCTACTCCTAGG + Intergenic
994083914 5:95738147-95738169 GACCCAACAATCCCGCTCCTGGG - Intronic
995252511 5:110009710-110009732 TACCCTAAATTCTTGCTTCTTGG - Intergenic
997123850 5:131205537-131205559 GACTCAACAGTTCTGCTCCTTGG - Intergenic
998565945 5:143215968-143215990 GACCCTGCAATCCCACTCCTAGG - Intronic
998638482 5:143983360-143983382 GACCCAGCAATCCTGTTCCTGGG - Intergenic
1000648209 5:163783846-163783868 GACCCTACAATCCCACTTCTAGG - Intergenic
1001401072 5:171446700-171446722 GACCCTACTCTCCTTCTCCTTGG - Intronic
1002902689 6:1423416-1423438 CACCCTACAGTCCTGCCCCAAGG + Intergenic
1005023230 6:21437490-21437512 GACCCTTCGTTTCTACTCCTTGG - Intergenic
1008178350 6:48295944-48295966 GACCCAGCATTCATGTTCCTCGG - Intergenic
1009303072 6:62052113-62052135 GACCCAACAATCCCTCTCCTGGG + Intronic
1012539168 6:100340569-100340591 GATCCAACAGTCCTCCTCCTTGG + Intergenic
1012732733 6:102902356-102902378 GACCCCTCCTTTCTGCTCCTGGG - Intergenic
1013151428 6:107450055-107450077 GACCCAACAATTCTGCTTCTGGG - Intronic
1016602374 6:145877071-145877093 GACCCAACATTTCTACTCCTAGG - Intronic
1016897921 6:149072176-149072198 GACCCAGCAATTCTGCTCCTAGG + Intronic
1018653085 6:166007462-166007484 GACCCAACAACTCTGCTCCTGGG - Intergenic
1019267506 7:126556-126578 GACTCAACAATTCTGCTCCTAGG - Intergenic
1019563310 7:1668267-1668289 GACTCATCATGCCTGCTCCTGGG + Intergenic
1019695457 7:2443520-2443542 GACCCCACACTCCTACTCCTAGG - Intergenic
1019789855 7:3004132-3004154 GACCCCACATTCCGTCTCCATGG - Intronic
1021791008 7:24205486-24205508 GACCCTACTTTGCTGATCCTTGG + Intergenic
1022148262 7:27569971-27569993 GAGCCTCTCTTCCTGCTCCTTGG + Intronic
1023553503 7:41394424-41394446 GATCCAACAATCATGCTCCTTGG - Intergenic
1024087349 7:45905829-45905851 GACCCAACAATTCTGCTCCTGGG + Intergenic
1027344068 7:77239005-77239027 GACTCTTCATTCGTGCTGCTAGG + Intronic
1027866327 7:83652067-83652089 GACTATACTTTCCAGCTCCTTGG + Intergenic
1029536773 7:101162040-101162062 ATCCCTACATTCCTGGTCCTAGG - Intergenic
1030021870 7:105283262-105283284 GACCCAACAATTCTCCTCCTAGG + Intronic
1031501094 7:122517415-122517437 GACCCTACAATCCCACTCCTAGG - Intronic
1034393368 7:150802179-150802201 GACCCAAGATCCCGGCTCCTAGG - Intronic
1034865274 7:154636378-154636400 GGCCCTTCCTTCCTTCTCCTGGG + Intronic
1036293533 8:7517073-7517095 GAACCTACATTCCTCATCCTTGG + Intergenic
1036329028 8:7803922-7803944 GAACCTACATTCCTCATCCTTGG - Intergenic
1036483377 8:9157450-9157472 GACCTTTCATTCTTGCTACTGGG + Intronic
1036711578 8:11082856-11082878 GACTCCACTTTCCTGCTCTTGGG - Intronic
1039452409 8:37686042-37686064 GACCCAACAATTCTACTCCTAGG + Intergenic
1039984114 8:42433870-42433892 GACCCAGCATTCCTGCTTCCGGG - Intronic
1040879542 8:52190433-52190455 GACCCTACAAGACTGATCCTGGG + Intronic
1041310174 8:56508927-56508949 GAACCTGGATTCCTGCTTCTGGG - Intergenic
1042248289 8:66729638-66729660 GACCCAGCACTTCTGCTCCTAGG - Intronic
1044394176 8:91690158-91690180 GACCCAACAATCCTTCTTCTGGG + Intergenic
1045841369 8:106585819-106585841 GGCCTTACTTTCCTGCTTCTTGG - Intronic
1046498673 8:115046838-115046860 GATCCTGCAATCCTGCTACTGGG + Intergenic
1046931773 8:119848592-119848614 GACCCATCAATTCTGCTCCTAGG + Intronic
1049475537 8:142795457-142795479 GACCCGAGCTCCCTGCTCCTGGG + Intergenic
1050644419 9:7703339-7703361 CATCCTACATTGCTGCTGCTTGG + Intergenic
1052995191 9:34548144-34548166 TGCCCTTCATTCCTGCTCCTAGG - Intergenic
1053262388 9:36679744-36679766 GACCCAGCAATTCTGCTCCTAGG - Intergenic
1054840018 9:69728291-69728313 GACCCTGTAATTCTGCTCCTAGG - Intronic
1054901698 9:70375777-70375799 GACTCTACATCCCTGTTCCTGGG + Intergenic
1055654762 9:78441094-78441116 GACCCTACTTTCCTGCTGTGGGG + Intergenic
1057443821 9:95099861-95099883 GCCCCTTCCTTCCTTCTCCTGGG - Exonic
1057875472 9:98750533-98750555 GACCCAGCAGTCCTACTCCTAGG - Intronic
1058180056 9:101786623-101786645 AACCCTACCTTCCTGCTTATTGG - Intergenic
1058718532 9:107742867-107742889 GACCTTCCTTTCCTTCTCCTTGG + Intergenic
1062493838 9:136822284-136822306 GAGCCTGCAGACCTGCTCCTTGG + Intronic
1062520487 9:136955726-136955748 GCCCCTCCATCCCTGCCCCTTGG + Intronic
1186067545 X:5782531-5782553 GACACTTCATTACAGCTCCTGGG - Intergenic
1187020270 X:15374199-15374221 GACCCAACAGTCCTACTTCTGGG + Intronic
1187351633 X:18523854-18523876 GACCCAACAATGCTACTCCTAGG - Intronic
1187674442 X:21701741-21701763 GCTCCTACCCTCCTGCTCCTGGG + Intergenic
1188657918 X:32721218-32721240 GACCCAACAATCCCACTCCTGGG - Intronic
1189400940 X:40667926-40667948 GGCCCTTCCTTCCTGCTACTTGG - Intronic
1189742781 X:44137891-44137913 GACCCTAGACTTCTACTCCTAGG + Intergenic
1189887025 X:45557671-45557693 GACCCCACAATTCTGCTCCTAGG - Intergenic
1190009671 X:46773511-46773533 GATCCAGCATTCCTACTCCTGGG + Intergenic
1190308739 X:49101754-49101776 CCCCCTACATCCCTGCACCTCGG - Intergenic
1190690224 X:52907666-52907688 GGCCCCACATCCCTCCTCCTGGG + Exonic
1190695759 X:52948126-52948148 GGCCCCACATCCCTCCTCCTGGG - Exonic
1190720092 X:53140541-53140563 GACCCAACAATTCTGTTCCTGGG + Intergenic
1192258839 X:69491096-69491118 GACCCAACATTTCCACTCCTAGG + Intergenic
1192381460 X:70620586-70620608 GACCCAGCAATCATGCTCCTCGG + Intronic
1192808353 X:74529213-74529235 GTCCTTTCCTTCCTGCTCCTGGG + Exonic
1193750218 X:85333141-85333163 CACCATACATTCCTGCCTCTAGG + Intronic
1194702699 X:97133775-97133797 GAAGCTTCATTCCTGCTCCATGG - Intronic
1194961554 X:100242283-100242305 GTCCCAACATTCCTTCTTCTGGG + Intergenic
1195120706 X:101748720-101748742 GACCCAACATGTCTGCTCCAGGG + Intergenic
1197461346 X:126745579-126745601 AACCCGACAGTCGTGCTCCTTGG - Intergenic
1198367543 X:135957072-135957094 GACCCAGCAATTCTGCTCCTCGG + Intergenic
1198885975 X:141337743-141337765 GATCCAACAATCCTACTCCTGGG - Intergenic