ID: 1112423196

View in Genome Browser
Species Human (GRCh38)
Location 13:99272490-99272512
Sequence AAACTCGTGCTGTCATAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112423193_1112423196 23 Left 1112423193 13:99272444-99272466 CCCAGGAGCAGGAATGTAGGGTC 0: 1
1: 0
2: 1
3: 31
4: 281
Right 1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 50
1112423194_1112423196 22 Left 1112423194 13:99272445-99272467 CCAGGAGCAGGAATGTAGGGTCA 0: 1
1: 0
2: 2
3: 20
4: 194
Right 1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112423196 Original CRISPR AAACTCGTGCTGTCATAGAG TGG Intronic
914684571 1:149967136-149967158 AAACTTGTGCTGTCAAAGAATGG - Intronic
920187878 1:204172988-204173010 AAGTTGGTGCTGTCATAGAAGGG - Intergenic
1070996646 10:80789513-80789535 AAAGTTGTGCTGTCAGGGAGAGG - Intergenic
1079747341 11:24150187-24150209 AAACTCGTGCTGTGCTGGAGGGG + Intergenic
1083851237 11:65368530-65368552 AAACTCTAGCTGGCATACAGAGG - Intergenic
1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG + Intronic
1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG + Intronic
1093699018 12:22196776-22196798 AAACTCGTGCTGTCTAAATGTGG - Exonic
1108802743 13:54119482-54119504 AAACTTGTGCTTCGATAGAGAGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1118386761 14:65262144-65262166 AGATTAGTGCTGTCATAAAGAGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1125513555 15:40305763-40305785 AAACAGGTGCTGTCATAAATTGG - Intronic
1131723718 15:95200626-95200648 AAACTGGTGCTGGTAGAGAGAGG + Intergenic
1137670745 16:50277021-50277043 AAACTCTTGATTTCACAGAGTGG - Intronic
1140957607 16:79880074-79880096 AAACTAGTATTGTGATAGAGTGG - Intergenic
1142589571 17:996637-996659 CACCTCGTGCTGTCATCGGGCGG - Intergenic
1143762758 17:9116847-9116869 ATACTCGTCCTTTCATAGAGTGG - Intronic
1154033956 18:10780221-10780243 AAAATCGTGTTGTCAGATAGTGG - Intronic
1164803537 19:31098056-31098078 AAACTCCTGCTGAATTAGAGAGG + Intergenic
1167061752 19:47153013-47153035 AAACTCATGCTCTCCTAGATTGG - Exonic
926243470 2:11105124-11105146 AACCTCGTCCTGTCACAGCGTGG - Intergenic
927213738 2:20654106-20654128 AATCTCCAGCTGTCCTAGAGTGG - Intergenic
931701773 2:64914888-64914910 AAACTCGCCCTGTTACAGAGTGG - Intergenic
939604531 2:144237643-144237665 CAACTTGTGCTGTCAAAGAAAGG + Intronic
941440955 2:165535670-165535692 AAAATCTTGCTGGCCTAGAGAGG + Intronic
1170495426 20:16919540-16919562 AAACTCATGGGGTCATAGAAAGG + Intergenic
949835147 3:8260207-8260229 AAACTCATACTGTCATACTGAGG + Intergenic
951892662 3:27581595-27581617 GAACTGTTGCTGTCAAAGAGAGG - Intergenic
955311236 3:57888922-57888944 AATCTCGCTCTGTCATACAGTGG + Intronic
955985411 3:64568645-64568667 AAACTGGCGCTGTAAAAGAGGGG - Intronic
957471431 3:80662587-80662609 AAAATCTTGCTGTCATCTAGAGG + Intergenic
957919962 3:86733876-86733898 AAACTCCTGCTGTCCCATAGCGG - Intergenic
960181457 3:114585211-114585233 GAACTGGTGATGTCCTAGAGAGG + Intronic
969272398 4:6111690-6111712 AAGCACGGGCTGTCACAGAGGGG - Intronic
973856305 4:55013775-55013797 AAACTCTTGTGGTCATAGCGTGG - Intergenic
974755610 4:66203229-66203251 ATACTCGTGCTGTGATAAAAGGG - Intergenic
975259210 4:72276419-72276441 AAATTCCTGCTGTCCTATAGAGG - Intergenic
980505969 4:133721763-133721785 AAACAAGTGCTATCATACAGTGG - Intergenic
997817702 5:137034618-137034640 AAACTCGGGTTGTCTCAGAGAGG + Intronic
1007229133 6:40336217-40336239 AAACTCATTTTGTCATAGACAGG - Intergenic
1009773765 6:68178416-68178438 AAATTCCTGGTTTCATAGAGAGG - Intergenic
1014715486 6:124860380-124860402 AAACTCTTGATATGATAGAGAGG + Intergenic
1015628290 6:135204677-135204699 AAACAATTGCTGTCAGAGAGAGG - Intronic
1018418376 6:163620926-163620948 ACTCTCGTGCTGCCACAGAGTGG - Intergenic
1019490121 7:1308636-1308658 AGTCTCGGGCTGTCACAGAGGGG + Intergenic
1027824977 7:83100607-83100629 GAACACGTGCTCACATAGAGAGG + Intronic
1034548026 7:151801683-151801705 AAACTCATTCTGTTCTAGAGGGG + Intronic
1041853386 8:62419521-62419543 CAAGTAATGCTGTCATAGAGAGG + Intronic
1052059970 9:23947566-23947588 AAACTAGTGCTGTCTAAAAGAGG - Intergenic
1059948655 9:119439079-119439101 TAATTCGTGCTGTGATGGAGTGG - Intergenic
1060760672 9:126245562-126245584 AAACTTGTGCAGTCACACAGAGG + Intergenic
1187927232 X:24261424-24261446 AAACTGGTGATGTGGTAGAGAGG - Intergenic
1188250917 X:27893139-27893161 AAGTACATGCTGTCATAGAGAGG + Intergenic