ID: 1112428985

View in Genome Browser
Species Human (GRCh38)
Location 13:99332891-99332913
Sequence CCTGCTTTTCAGAGGGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 404}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112428974_1112428985 23 Left 1112428974 13:99332845-99332867 CCCAGCCCCCTGACACACAAATC 0: 1
1: 0
2: 1
3: 15
4: 227
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428977_1112428985 17 Left 1112428977 13:99332851-99332873 CCCCTGACACACAAATCCAACAT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428973_1112428985 24 Left 1112428973 13:99332844-99332866 CCCCAGCCCCCTGACACACAAAT 0: 1
1: 0
2: 1
3: 50
4: 462
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428972_1112428985 25 Left 1112428972 13:99332843-99332865 CCCCCAGCCCCCTGACACACAAA 0: 1
1: 0
2: 7
3: 61
4: 617
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428981_1112428985 1 Left 1112428981 13:99332867-99332889 CCAACATATGGTCTTTTTCTAAA 0: 1
1: 0
2: 2
3: 32
4: 360
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428978_1112428985 16 Left 1112428978 13:99332852-99332874 CCCTGACACACAAATCCAACATA 0: 1
1: 0
2: 2
3: 17
4: 234
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428975_1112428985 22 Left 1112428975 13:99332846-99332868 CCAGCCCCCTGACACACAAATCC 0: 1
1: 0
2: 0
3: 30
4: 310
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428979_1112428985 15 Left 1112428979 13:99332853-99332875 CCTGACACACAAATCCAACATAT 0: 1
1: 0
2: 1
3: 28
4: 245
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404
1112428976_1112428985 18 Left 1112428976 13:99332850-99332872 CCCCCTGACACACAAATCCAACA 0: 1
1: 0
2: 2
3: 27
4: 299
Right 1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG 0: 1
1: 0
2: 2
3: 21
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112428985 Original CRISPR CCTGCTTTTCAGAGGGTCTA TGG Intronic
901066360 1:6496543-6496565 CCTTCTTTTCAGCGGGGCTCTGG + Exonic
902084502 1:13848668-13848690 CCTATATTTCAGAGGGTATATGG + Intergenic
903228989 1:21910421-21910443 CCAGCTTTTCTGAGGGTCTCAGG - Intronic
903405322 1:23090858-23090880 CATGCTGTTCTGAGGGCCTACGG + Intronic
904375120 1:30076307-30076329 CCTGAATTTCAGAGGATGTATGG + Intergenic
904465807 1:30707021-30707043 CCTGATTTTCAGAGACTCTGGGG - Intergenic
907259411 1:53206217-53206239 CCTACATTTCAGAGGCTATATGG + Intronic
907337872 1:53712251-53712273 TCTGATTTTCACAGGGTCTCTGG - Intronic
908028093 1:59971892-59971914 CCTGCTTTTCTGAAGGGCTTTGG + Intergenic
908159866 1:61396200-61396222 AATGCTTTTCAGAAGATCTAGGG - Intronic
908407742 1:63831369-63831391 CCTAGATTTCAGAGGATCTATGG - Intronic
908663431 1:66462755-66462777 CCTAGATTTCAGAGGATCTATGG + Intergenic
908837869 1:68246077-68246099 TCTTCTTTTCATAGGGTCTGTGG + Intergenic
908885194 1:68780871-68780893 CCTAGATTTCAGAGGGTGTATGG + Intergenic
909879417 1:80854727-80854749 ACTGTTTTTCAGAGGGTATGTGG - Intergenic
911051425 1:93674838-93674860 CCTGCTGCTCAGAAGGTCCATGG + Exonic
911175136 1:94810964-94810986 CCTGCTCTTCAGAGGTACAAGGG + Intergenic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
911718054 1:101158235-101158257 CAAGCATTTCAGAGAGTCTAGGG - Intergenic
911780359 1:101868964-101868986 CCTGGATTTCAGAGGATGTATGG + Intronic
911790932 1:102014538-102014560 CCTGGTTTTCAGAGTATGTATGG + Intergenic
911904318 1:103547877-103547899 CCTGGATTTCAGAGGATATATGG - Intronic
913331672 1:117672802-117672824 CCTGCTTCTCAGAGGGTACAAGG - Intergenic
915571001 1:156744968-156744990 TCTGCTTTCCAGGGGGTCTCTGG + Intronic
916668543 1:166989808-166989830 CCTGCTTCTCTGAGGGCCCAGGG - Exonic
916714723 1:167439307-167439329 CTTCCTTTCCGGAGGGTCTACGG + Intronic
917676994 1:177328766-177328788 CCTGCTGTTCAGATTGTCTGTGG + Intergenic
918531157 1:185524075-185524097 CCTAGATTTCAGAGGGTATATGG - Intergenic
918751281 1:188272596-188272618 CCTGCTTTTCTGAGAGTGCAGGG - Intergenic
919156792 1:193776001-193776023 CCTACATTTCAGAGGATGTATGG - Intergenic
919212862 1:194510655-194510677 CCTAGATTTCAGTGGGTCTATGG + Intergenic
919930501 1:202218252-202218274 CCTGCTATTCAGGGGGTGTTTGG + Intronic
920417791 1:205810355-205810377 CCTGCTCTTCAGATGGCCCAGGG - Exonic
920597941 1:207291869-207291891 CCTGATTTTCAGAGGATGTATGG + Intergenic
920785302 1:209035140-209035162 CCTGGATTTCAGAGGATGTATGG - Intergenic
921434717 1:215105203-215105225 CTTGCTGTTCAGTGGGTATAGGG - Intronic
921466356 1:215492688-215492710 CCTACATTTCAGAGGTTGTATGG + Intergenic
922161931 1:223084496-223084518 CCTTCTTTCCTGAGGGCCTAAGG - Intergenic
923325454 1:232876423-232876445 CCATCTTTTCAGAGGCTATAAGG - Intergenic
923494930 1:234515720-234515742 CCAGCTTTGCAGTGGTTCTAAGG + Intergenic
923871229 1:237996262-237996284 CATGCTTTTAGGAGAGTCTAAGG - Intergenic
923912737 1:238467148-238467170 CCTGCTTCTGAAAGGGTATATGG + Intergenic
923932840 1:238722144-238722166 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1064566272 10:16641922-16641944 CCAGCTTGTCAGAGGGTCCTGGG - Intronic
1065102675 10:22345944-22345966 CATTCTTTTCAGCGGGTCTTTGG + Intronic
1067158267 10:43800907-43800929 CCTGCTTTTCAGAGACTAAATGG + Intergenic
1067364907 10:45617315-45617337 CCTGCTTTTTAGAGTGTATTCGG - Intronic
1069174927 10:65279309-65279331 CCTTGATTTCAGAGGGTATATGG + Intergenic
1069441078 10:68428570-68428592 CCAGATTTTCAGAGGGTGAATGG + Intronic
1070140683 10:73734983-73735005 CCTGCCCTTCAGATGTTCTAGGG + Intergenic
1070178780 10:73995533-73995555 CCTGCCTGTCTGTGGGTCTAAGG + Intergenic
1072358239 10:94633373-94633395 CCTGGATTTCAGAGGATGTATGG + Intergenic
1074260493 10:111848637-111848659 CCTAGATTTCAGAGGATCTATGG + Intergenic
1075269593 10:121037036-121037058 CCTGCTTTTCTGAGGAGCTCAGG - Intergenic
1075738639 10:124679667-124679689 CCTGCTTGGCAGTGGGTCTCGGG - Intronic
1076501436 10:130939513-130939535 CCTGCTTTCAAGTGGGTCTGGGG - Intergenic
1076689750 10:132216859-132216881 CCTGCATTTCAGAGGATGTATGG + Intronic
1076716015 10:132364180-132364202 CTTGCTTTTCAGAGTAACTATGG - Intronic
1078853856 11:15190426-15190448 GCTGATTTTCTGAGGGACTAGGG + Intronic
1078978609 11:16505912-16505934 CCTGGATTTCAGAGGATGTATGG + Intronic
1079302696 11:19293067-19293089 CCTGCTTTTCATTTGGTGTATGG + Intergenic
1079455272 11:20630940-20630962 CCTTCTTTACAGAGGGACCAAGG + Intronic
1079554308 11:21740280-21740302 CCTAGATTTCAGAGGGTTTATGG - Intergenic
1080958531 11:37130400-37130422 CCTACATTTCAGAGGATCTATGG + Intergenic
1082781095 11:57287965-57287987 GGTGTTTTTCAGAGGGTCAAGGG - Intergenic
1083300832 11:61738907-61738929 CCTGCCTGCCACAGGGTCTAGGG - Intronic
1083495816 11:63052236-63052258 CCTGGATTTCAGAGGATGTATGG + Intergenic
1083659968 11:64247404-64247426 CCTGCTACTCGGAGAGTCTAGGG - Intergenic
1083752184 11:64766818-64766840 CCTGCTTGTGTGAGGCTCTATGG + Intronic
1083829244 11:65220879-65220901 CCTGTGTCTCAGAGGGTCTCTGG + Intergenic
1085525433 11:77160961-77160983 ACTGCCTTTCAGGGGATCTACGG + Exonic
1086826738 11:91507868-91507890 CCTGGATTTCAGAGGATGTATGG - Intergenic
1087731111 11:101779581-101779603 CCTGGATTTCAGAGGATGTATGG + Intronic
1087877478 11:103375230-103375252 CCTAGATTTCAGAGGGTGTATGG + Intronic
1090959476 11:131543421-131543443 CCTGCTCTTCTGTGGGTCTTGGG - Intronic
1092643034 12:10537714-10537736 CCTGGATTTCAGAGGCTCTATGG - Intergenic
1093192574 12:16091963-16091985 CCTAGTTTTCAGAGGATGTATGG - Intergenic
1093570528 12:20661735-20661757 CCTATATTTCAGAGGGTGTACGG + Intronic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1094268325 12:28584029-28584051 CCTGCATTTCTGAGGGTTTCTGG + Intergenic
1094798468 12:34002469-34002491 CCTGGATTTCAGAGGATGTATGG - Intergenic
1095919731 12:47517079-47517101 CCTGAATTTCAGAGGATGTATGG - Intergenic
1096455437 12:51781116-51781138 TGTGCTTTTCAGTGGGTCTGTGG - Intronic
1096566092 12:52480483-52480505 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1096840670 12:54377926-54377948 CCTGCTCTCCAGAGGGGCTGAGG + Intronic
1097996545 12:65893649-65893671 CCTGCATTTCAGGGGGTGAATGG + Intronic
1099214608 12:79838758-79838780 CCTAGATTTCAGAGGGTGTATGG + Intronic
1099356726 12:81646326-81646348 CCTGTTCTCTAGAGGGTCTAGGG - Intronic
1099621285 12:85005504-85005526 CCTAGATTTCAGAGGATCTATGG + Intergenic
1100924655 12:99531016-99531038 CCTGCTACTCAGAGGGAATAAGG - Intronic
1101193041 12:102354519-102354541 CCTACATTTCAGAGGGTGTATGG - Intergenic
1102008277 12:109602586-109602608 CCTGGGTTTCAGAGTGTCTTGGG + Intergenic
1102544701 12:113646086-113646108 CCTGCTTTGCAGAGGGGATGCGG + Intergenic
1104809798 12:131613218-131613240 CCTGGGTTACAGAGGGTCCAGGG - Intergenic
1105528900 13:21200536-21200558 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1107188366 13:37549903-37549925 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1107227948 13:38073421-38073443 CCAGCTTTTCAGGGGTTCTTAGG + Intergenic
1107524072 13:41213236-41213258 CCTGGTATACAGAGGGACTAGGG + Intergenic
1108885676 13:55178467-55178489 CCTGGATTTCAGAGGATGTATGG + Intergenic
1109098287 13:58145256-58145278 CCTGGATTTCAGAGGATGTATGG + Intergenic
1109503415 13:63267754-63267776 CCTGGATTTCAGAGGATATATGG - Intergenic
1109717402 13:66234440-66234462 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1110502826 13:76248929-76248951 CCTTCCTTTCAGAGGCTCTGAGG + Intergenic
1110763123 13:79252445-79252467 CCTGCTTTACAGTGGGGCAAGGG + Intergenic
1111227105 13:85288606-85288628 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1111302661 13:86365776-86365798 CCTGTATTTCAGAGGATATATGG + Intergenic
1112428985 13:99332891-99332913 CCTGCTTTTCAGAGGGTCTATGG + Intronic
1114925265 14:27389539-27389561 GCTTCTTTTTAGAGGGTTTAAGG - Intergenic
1114948413 14:27715966-27715988 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1115134803 14:30095697-30095719 CCTAGATTTCAGAGGATCTATGG + Intronic
1115932135 14:38508787-38508809 CCTGGATTTCAGAGGATGTATGG - Intergenic
1116024787 14:39502025-39502047 ACTGCTTTTCACAGGGGCTGAGG + Intergenic
1118083355 14:62387443-62387465 CCTGGATTTCAGAGGATATATGG + Intergenic
1119007372 14:70943975-70943997 CCTGGATTTCAGAGGATGTATGG + Intronic
1119450141 14:74702301-74702323 CCTGGATTTCAGAGGATGTATGG - Intronic
1121418376 14:93795079-93795101 CCAGCTCTTCAGTGGGTCTGAGG - Intergenic
1121699555 14:95942285-95942307 CCTAGATTTCAGAGGGTATATGG + Intergenic
1124556067 15:30727088-30727110 CCTAGATTTCAGAGGATCTATGG - Intronic
1124675207 15:31678682-31678704 CCTAGATTTCAGAGGATCTATGG + Intronic
1126533248 15:49733233-49733255 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1127730056 15:61791696-61791718 CCTACTTCTCACAGGCTCTAAGG + Intergenic
1128460255 15:67861597-67861619 TCTGCTTTTCACAGGGGATAGGG - Intergenic
1129812781 15:78524207-78524229 CCTGGATTTCAGAGGATGTATGG - Intronic
1130301315 15:82681313-82681335 GCTGCTTCTCAGAGGGTTTGAGG - Intronic
1131427037 15:92354228-92354250 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1131921452 15:97332899-97332921 CCTGGATTTCAGAGGGTATATGG + Intergenic
1132539677 16:502909-502931 CCTGCTTTTCAGATTGACTTGGG + Intronic
1132662808 16:1069136-1069158 CCTGCTTTTCAGTGAGTGGAGGG - Intergenic
1132787355 16:1665068-1665090 ACTGGTTTTCCGATGGTCTAGGG - Exonic
1133484820 16:6209646-6209668 CCTGCTATTCAGAAGGTCTCAGG - Intronic
1135392396 16:22104858-22104880 TCTGCTTTTCCCAGGGTTTAAGG - Intronic
1136065117 16:27753554-27753576 CCTGGTCTTCAGAGAGTCAACGG - Intronic
1136293838 16:29290818-29290840 GCTGCTTTCCAGTGGGTCTGGGG + Intergenic
1137674059 16:50295126-50295148 GCTGCTTTTCACAGGATCTGAGG + Intronic
1139172765 16:64650821-64650843 CCTGGATTTCAGAGGATGTATGG - Intergenic
1139282612 16:65783701-65783723 ACTGCCTCTCAGTGGGTCTAGGG - Intergenic
1141251368 16:82362011-82362033 CCTGATTTACAGAGGGTCATGGG + Intergenic
1141344443 16:83232038-83232060 CGGGCTTTTCAGAGGGTAGAGGG + Intronic
1142099738 16:88264864-88264886 GCTGCTTTCCAGTGGGTCTGGGG + Intergenic
1142711355 17:1725494-1725516 CAGGCTCTGCAGAGGGTCTATGG + Exonic
1144968472 17:19092537-19092559 CATGCTTTTCAGAGGCTAGAGGG + Intergenic
1144979445 17:19159526-19159548 CATGCTTTTCAGAGGCTAGAGGG - Intergenic
1144988777 17:19218706-19218728 CATGCTTTTCAGAGGCTAGAGGG + Intronic
1150647530 17:66988634-66988656 GCTGCTCTCCAGAGGCTCTAAGG + Intronic
1151400948 17:73855680-73855702 CGTGCCTTCCAGAGGCTCTAGGG - Intergenic
1151500982 17:74488706-74488728 CCTGGATTTCAGAGGATGTATGG - Intergenic
1152989415 18:349390-349412 CCTGGATTTCAGAGGATGTATGG + Intronic
1153153766 18:2126111-2126133 CCTTCATTTCAGAGGGTCTAGGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1155925745 18:31653036-31653058 CATGATTTTCAAAGGGTCTAGGG - Intronic
1156265901 18:35488352-35488374 CCTACATTTCAGAGGATGTATGG - Intronic
1156509728 18:37626294-37626316 CCTTCTTTCCAGATGGTCTTGGG + Intergenic
1156615006 18:38772655-38772677 CCTACATTTCAGAGGATGTATGG - Intergenic
1156904449 18:42336901-42336923 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1158071448 18:53475616-53475638 CCTGGATTTCAGAGGATATATGG + Intronic
1159196092 18:65117249-65117271 CTTTCTTTTCAGAGCATCTAGGG - Intergenic
1159215574 18:65387030-65387052 CCTACATTTCAGAGGATGTATGG + Intergenic
1160060800 18:75527203-75527225 CCTCCTTTTCAGGGGGTGCAGGG - Intergenic
1164947881 19:32311506-32311528 TCTGCTTTCCAGAGGGTCCTGGG - Intergenic
1166862556 19:45818549-45818571 CCAGCTTGTCAGAGGGCCAAGGG + Intronic
1167096960 19:47379715-47379737 CCTGCTTTTTAGCCGGTCTTTGG + Exonic
925029790 2:641560-641582 CATGCTTTTCAGAGTTCCTAGGG + Intergenic
925817029 2:7763661-7763683 CCTGGATTTCAGAGGATGTATGG - Intergenic
926157341 2:10463901-10463923 CCTGCTTTTCAGGGGGCCTGTGG + Intergenic
926375537 2:12223879-12223901 CCTACATTTCAGAGGATATATGG + Intergenic
926418473 2:12674253-12674275 CCTGCTTATCAGAGGCTCCTGGG + Intergenic
926483957 2:13432398-13432420 CCTAGATTTCAGAGGATCTATGG - Intergenic
928360798 2:30660668-30660690 CCTGCTTTTCAGAGGGTACGGGG + Intergenic
928649474 2:33389422-33389444 CCTGCTGGTCAGAAAGTCTAGGG + Intronic
929129341 2:38551613-38551635 GCTGCTTTCCGGAGGCTCTAGGG + Intergenic
929382499 2:41369049-41369071 CCTACATTTCAGAGGATGTATGG - Intergenic
930480612 2:51943891-51943913 GCTGCATTTCAGAGGATGTATGG + Intergenic
930927375 2:56835010-56835032 CCTCCTTTTCAGACTGTCTCTGG - Intergenic
931529657 2:63199620-63199642 CCTACATTTCAGAGGATGTATGG + Intronic
932015583 2:68023626-68023648 GGTGCTGTTCAGAGGGTCTGAGG + Intergenic
932398204 2:71462546-71462568 CCTGCTGTTCAGTGGGTCCTGGG + Intronic
933046190 2:77540042-77540064 CCTGGATTTCAGAGGATGTATGG + Intronic
933700200 2:85249586-85249608 CCTGCTTTTCTGGGGGTCTGCGG + Intronic
934695160 2:96394735-96394757 CCTGCTTTTCAGAAGGCTTGGGG + Intergenic
935527461 2:104188321-104188343 CCTGCTTTTCAGTTGGTTCAAGG + Intergenic
936473155 2:112816493-112816515 CCTGGTATTCAGAGGGATTAGGG + Intergenic
937223649 2:120356211-120356233 CCTGCTCCTCTGAGGGCCTAGGG - Intergenic
938083829 2:128385259-128385281 CGTGGTTTCCAGAGGGTCTCAGG - Intergenic
938701375 2:133883164-133883186 GTTGCTTCTCAGAGGGTCCAAGG - Intergenic
941408418 2:165121342-165121364 CCTCCTTTTCAGAGTCTTTATGG - Intronic
942889012 2:180964813-180964835 CCTGCATTTCAGAAGTTGTATGG + Intergenic
943271566 2:185811903-185811925 CCTAGATTTCAGAGGGTGTATGG + Intronic
945127407 2:206527890-206527912 GCTACTTTTCAGGAGGTCTATGG - Intronic
945258951 2:207826419-207826441 CCTGCTTTTCTAAGGGTAAAAGG + Intergenic
945720688 2:213415235-213415257 CAAGCTTTTCAGAGGGGCCAGGG + Intronic
946580977 2:221128064-221128086 CCTAAATTTCAGAGGGTGTATGG + Intergenic
946937439 2:224736586-224736608 CCTGGATTTCAGAGGATGTATGG + Intergenic
947396695 2:229694206-229694228 CCTACATTTCAGAGGGTGCATGG + Intronic
1169153094 20:3305914-3305936 CCTCCTTTTCAGAGGGCCTCAGG - Intronic
1169857987 20:10124208-10124230 CCTGGATTTCAGAGGATGTATGG - Intergenic
1171108972 20:22463145-22463167 CCTGCTTTTCAGCCGGCATAGGG + Intergenic
1171112235 20:22494782-22494804 ACTGGTTTTCAGAGTGTCTTAGG + Intergenic
1171399687 20:24864847-24864869 CCTATGTTTCAGAGGGTGTATGG + Intergenic
1173875101 20:46365304-46365326 CCTTCTGTTCAGAGGGGCCAGGG - Intergenic
1175013597 20:55764749-55764771 CCTGGATTTCAGAGGATATATGG - Intergenic
1175181221 20:57149033-57149055 CCAGCTTTTCCGTGGGGCTATGG - Intergenic
1175207287 20:57321024-57321046 CCTGGTTTTCAGAGTGTTCAGGG + Intergenic
1175456656 20:59120474-59120496 GCTGCTGATCAGAGGGTCCAAGG + Intergenic
1175822262 20:61916654-61916676 CCTGCTCTTCTGAGGGACTCAGG - Intronic
1177473087 21:21584105-21584127 CCTACATTTCAGAGGATGTATGG + Intergenic
1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG + Intergenic
1178154207 21:29832465-29832487 CCTAGATTTCAGAGGGTGTATGG - Intronic
1179718935 21:43304694-43304716 GCTGCTGTTGAGAGGGTCTGTGG + Intergenic
1179964187 21:44791581-44791603 CCTACATTTCAGAGGATGTAGGG + Intronic
1180251704 21:46594502-46594524 CCTGCTGTTCAGCGGGTCCCAGG - Intergenic
1182576008 22:31273385-31273407 CCTGCTCTGCACTGGGTCTAGGG - Intronic
1183831646 22:40421243-40421265 TCTGCTTTTCACGGGGTGTACGG - Intronic
949463347 3:4318028-4318050 CCTGCATTTTAGAGTGCCTAAGG + Intronic
949635964 3:5981678-5981700 CCTAGTTTTCAGAGGATGTATGG - Intergenic
949770352 3:7570866-7570888 CCTGGATTTCAGAGGATGTATGG - Intronic
950669462 3:14517400-14517422 GCTGAGTTTCACAGGGTCTATGG - Intronic
951158580 3:19386751-19386773 GCTGCTTTTCAGATGGATTATGG + Intronic
951245106 3:20331724-20331746 CCTGCTCTTTAGAGAGTTTACGG - Intergenic
951538776 3:23763220-23763242 GCTGCTTTGCAGAGGGTCGTGGG + Intergenic
951583535 3:24191386-24191408 CCTCCTTTTCAGAGTTTATATGG + Intronic
952330633 3:32361507-32361529 CTTGCTTTTCAGAGCATTTAGGG + Intronic
952424191 3:33158274-33158296 GCGTCTTTTCAGAGGGTCTTCGG - Intronic
952693369 3:36236664-36236686 ACTGCTTTTCACAGGGGCTGAGG - Intergenic
953456546 3:43046959-43046981 CCTGTATTTCAGAGGATGTATGG + Intronic
954516940 3:51186855-51186877 CCTGGATTTCAGAGGATGTATGG + Intronic
954758117 3:52853580-52853602 CCTCCTTTGCAGTGAGTCTAGGG - Intronic
955131163 3:56170511-56170533 CTTGCTTTTTAGAGGAACTAAGG - Intronic
955465254 3:59230363-59230385 CCTGGATTTCAGAGGATGTATGG - Intergenic
957300916 3:78390352-78390374 CCTACATTTCAGAGGATGTATGG + Intergenic
957557522 3:81780783-81780805 CCTACATTTCAGAGGATGTATGG - Intergenic
958463262 3:94426370-94426392 CCTAGATTTCAGAGGGTGTATGG + Intergenic
958650067 3:96927046-96927068 CCTGCATTTCAGAGAATGTATGG - Intronic
958688054 3:97425338-97425360 CCTATATTTCAGAGGGTATATGG - Intronic
959228664 3:103619082-103619104 CCTAGATTTCAGAGGGTCTATGG - Intergenic
959267950 3:104167805-104167827 CCTACATTTCAGAGGATGTATGG - Intergenic
960192464 3:114723385-114723407 ACAGCTTTTCAGAGGCTCAAAGG + Intronic
961314992 3:126028480-126028502 CCTGGATTTCAGAGGATGTATGG + Intronic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
964479642 3:157128567-157128589 CCTGCTCTTCTGAGAGTCTGAGG - Intergenic
965066634 3:163858091-163858113 CCTAGATTTCAGAGGATCTATGG + Intergenic
965404862 3:168255881-168255903 CCTGGATTTCAGAGGATGTATGG - Intergenic
966581168 3:181565678-181565700 CCTGATTTTCAGAGCGACCAGGG + Intergenic
966666591 3:182478478-182478500 CCACCTTTTCAAAGGGTCAAAGG + Intergenic
966742605 3:183248471-183248493 CCTGCTTTACAGAGAGTACACGG - Intronic
967564660 3:190959543-190959565 CCTGGATTTCAGAGGATGTATGG + Intergenic
967609158 3:191483286-191483308 CCTAGATTTCAGAGGGTGTATGG + Intergenic
967777016 3:193395308-193395330 CCTACATTTCAGAGGATGTATGG - Intergenic
967964860 3:194953055-194953077 CCTCCTCTTTAGAGGGTCTGGGG - Intergenic
969415676 4:7056365-7056387 CCTGCTTTAAAGAGAGTCTTTGG + Exonic
969925330 4:10579909-10579931 CCTGATTTGCATAGGGTTTAGGG - Intronic
970360946 4:15308365-15308387 CCTGGATTTCAGAGTGTGTATGG - Intergenic
970949610 4:21738595-21738617 CCTGCTTTTCACAGTGTCTCTGG + Intronic
971900307 4:32650090-32650112 CCTGAATTTCAGAGGATGTATGG - Intergenic
972721333 4:41702052-41702074 TTTGCTTTTCAGAGTGTCTTGGG + Intergenic
974071445 4:57127736-57127758 CCTGGATTTCAGAGGATGTATGG + Intergenic
974981886 4:68967156-68967178 CCTACTTTTCAGAGGATGTACGG - Intergenic
975046229 4:69807750-69807772 CCTGGGTTTCAGAGGATGTATGG + Intergenic
976444803 4:85118066-85118088 CCTAGATTTCAGAGGCTCTATGG + Intergenic
977063795 4:92288315-92288337 CCTGGATTTCAGAGGATGTATGG - Intergenic
977711410 4:100130378-100130400 CCTGCTTTTTAGAGGCTCCTAGG + Intergenic
978265624 4:106821222-106821244 ACTGCATTTCAGAGGCTGTATGG + Intergenic
979079153 4:116312215-116312237 CCTGGATTTCAGAGGATGTATGG - Intergenic
979146169 4:117251457-117251479 CCTAAATTTCAGAGGGTGTATGG + Intergenic
979709209 4:123757943-123757965 CCTTCCTTTCAGATGGTCTCAGG + Intergenic
979951333 4:126897285-126897307 CCTGGATTTCAGAGGATGTATGG - Intergenic
980084456 4:128377224-128377246 CCTGGATTTCAGAGGATGTACGG - Intergenic
980153703 4:129079849-129079871 CCTGGATTTCAGAGGATATATGG - Intronic
980396602 4:132223552-132223574 CCTGGATTTCAGAGGATGTATGG + Intergenic
980650776 4:135712089-135712111 CCTAGATTTCAGAGGATCTATGG + Intergenic
981131380 4:141161870-141161892 CCTGTATTTCAGAGGATGTATGG + Intronic
981242394 4:142493164-142493186 CCTAGATTTCAGAGGGTGTATGG + Intronic
982299887 4:153867788-153867810 CCTAGTTTTCAGAGGATGTATGG + Intergenic
983333297 4:166359271-166359293 CCTGCTGTTCAGTGGGTCCCAGG + Intergenic
983467757 4:168116010-168116032 CTTGCTTTTCAAAGCATCTAGGG - Intronic
984856246 4:184198459-184198481 CCTGCTTCTCAGAGGGGCAGTGG + Intronic
984877988 4:184386368-184386390 CCTGGTTATCAAAGGGTTTAAGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
985833430 5:2252401-2252423 CTGGGTTTTCAGAGTGTCTAGGG - Intergenic
985973499 5:3395416-3395438 CCTGCATTTCAGAGGGACTAGGG + Intergenic
986137834 5:4999273-4999295 CCTACATTTCAGAGGATGTATGG - Intergenic
987359188 5:17091582-17091604 CCTGCTTTACAGTCGGTCCAGGG - Intronic
987597532 5:20020688-20020710 CCTCAATTTCAGAGGGTGTATGG + Intronic
987725540 5:21694604-21694626 CCTCATTTTCTGAGGGTTTAAGG - Intergenic
987786535 5:22507845-22507867 CCATCCCTTCAGAGGGTCTAGGG + Intronic
988074779 5:26338676-26338698 CCTACATTTCAGAGGATGTATGG - Intergenic
988275021 5:29069444-29069466 CCTAGATTTCAGAGGATCTATGG + Intergenic
988523526 5:31966873-31966895 CTTTCTTTTCAGAGGCTCTGTGG - Intronic
988579793 5:32458888-32458910 CCTACATTTCAGAGGATTTATGG - Intergenic
990291263 5:54354322-54354344 CCTGGATTTCAGAGGATGTATGG + Intergenic
991716235 5:69453490-69453512 CTTTCTTTTCTGAGGGGCTAGGG + Intergenic
991776359 5:70089533-70089555 CCTGGATTTCAGAGGATGTATGG + Intergenic
991855646 5:70964980-70965002 CCTGGATTTCAGAGGATGTATGG + Intergenic
991869658 5:71097758-71097780 CCTGGATTTCAGAGGATGTATGG + Intergenic
992310951 5:75498650-75498672 CCTACATTTCAGAGGATGTATGG + Intronic
993703892 5:91148531-91148553 CCTATATTTCAGAGGGTATATGG + Intronic
993835738 5:92818089-92818111 CCTGCTGTTCAGTGGGTTTCAGG - Intergenic
995011382 5:107260234-107260256 CCTGGATTTCAGAGGATATATGG - Intergenic
995832059 5:116364191-116364213 CATGAATTTCAGAGGATCTAGGG + Intronic
997088321 5:130826991-130827013 CCTACATTTCAGAGGATTTATGG - Intergenic
997274619 5:132574229-132574251 CCTAGATTTCAGAGGGTGTATGG - Intronic
998945943 5:147339352-147339374 CCTGGATTTCAGAGGATGTATGG + Intronic
1000548851 5:162634155-162634177 CCTGTATTTCAGAGGATGTATGG - Intergenic
1000628055 5:163562177-163562199 CTTGCTTTCCAGAGGTACTAGGG + Intergenic
1000861028 5:166456347-166456369 CCTTCTTTTCTGAGGGCCAAGGG - Intergenic
1002912367 6:1499803-1499825 ACTGCTTTTCAGAGGGAAAAAGG - Intergenic
1003000236 6:2325228-2325250 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1003167274 6:3691494-3691516 GTTGCTTTTCAGAGGATATAAGG + Intergenic
1003446739 6:6191759-6191781 GCTGCTTCTCAGAGGGCATATGG + Intronic
1005105349 6:22218669-22218691 CCTTCCTTCCAGAGGCTCTAGGG - Intergenic
1005228514 6:23671657-23671679 CCTAGTTTTCAGAGGATGTATGG - Intergenic
1005570124 6:27137018-27137040 CCTGCTTTTAAGGGGGTAAAAGG + Intergenic
1007827402 6:44611032-44611054 GCTCCTTTCCAGAGGCTCTAGGG + Intergenic
1009284964 6:61804610-61804632 CCTACATTTCAGAGGATGTATGG - Intronic
1009554752 6:65148776-65148798 CCTAGGTTTCAGAGGGTGTATGG - Intronic
1010610787 6:77952004-77952026 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1011747143 6:90417430-90417452 ACTGATTTTCAAATGGTCTATGG + Intergenic
1011784233 6:90826391-90826413 CCTGGATTTCAGAGGATGTACGG + Intergenic
1011942289 6:92857425-92857447 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1012014890 6:93837650-93837672 GGTGCTTTTCAGAGGGTGAAGGG + Intergenic
1012279296 6:97310078-97310100 CTTGTTTTTCAGTGTGTCTAAGG + Intergenic
1012732398 6:102899494-102899516 CCTGGATTTCAGAGGATGTATGG - Intergenic
1014247719 6:119084768-119084790 CCTAGATTTCAGAGGGTGTATGG - Intronic
1015347267 6:132174894-132174916 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1015379350 6:132549006-132549028 CATTCCTTTCAGAGGATCTAGGG - Intergenic
1016128328 6:140434135-140434157 CCTAGATTTCAGAGGATCTATGG + Intergenic
1016308050 6:142703800-142703822 CCTTCTTTCCAGAGGCTCTAGGG - Intergenic
1017229421 6:152056552-152056574 CCTGTTTTTCAGAAGCCCTAAGG - Intronic
1018075337 6:160207399-160207421 CCTCGATTTCAGAGGGTGTATGG - Intronic
1018482435 6:164205452-164205474 CCTGGATTTCAGAGGATGTATGG + Intergenic
1019123608 6:169824727-169824749 CCACTTTTTCAAAGGGTCTATGG + Intergenic
1020579037 7:9971356-9971378 CCTGTATTTCAGAGGATGTAAGG + Intergenic
1020581787 7:10011793-10011815 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1020837203 7:13168400-13168422 CCTACATTTCAGAGGATGTATGG - Intergenic
1021550629 7:21867645-21867667 TCTGATTTTCAGAGCTTCTAAGG + Intronic
1022705994 7:32802465-32802487 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1022712568 7:32865410-32865432 CCTGGATTTCAGAGGTTGTATGG - Intergenic
1022852752 7:34282189-34282211 CCTGTATTTCAGAGGATGTATGG - Intergenic
1022910432 7:34895589-34895611 CCTGGATTTCAGAGGATGTATGG + Intergenic
1023690302 7:42779336-42779358 CCTGGATTTCAGAGGATGTATGG + Intergenic
1024729258 7:52236109-52236131 CCTACATTTCAGAGGATGTATGG + Intergenic
1025143663 7:56485878-56485900 ACTGCATTTCAGAGGGTCTTTGG + Intergenic
1025259300 7:57406712-57406734 ACTGCATTTCAGAGGGTCTTTGG + Intergenic
1027395340 7:77747624-77747646 CCTAGTTTTCAGAGGCTGTATGG + Intronic
1027589604 7:80101138-80101160 CCTACTTTGCAGAGCGTCTGGGG - Intergenic
1027607972 7:80323729-80323751 CCAGCTGTACAGAGAGTCTAAGG + Intergenic
1028032430 7:85932956-85932978 CCTAGATTTCAGAGGGTGTATGG + Intergenic
1028099082 7:86798033-86798055 CCTGGATTTCAGAGGATGTATGG + Intronic
1029603383 7:101583233-101583255 CCAGCACTTCAGATGGTCTAAGG - Intergenic
1031194200 7:118591321-118591343 CCTACATTTCAGAGGATGTATGG + Intergenic
1031275223 7:119712698-119712720 CCTACATTTCAGAGGATGTATGG - Intergenic
1031872528 7:127102681-127102703 CCTACATTTCAGAGGATGTATGG + Intronic
1033444191 7:141405713-141405735 CCTGCCTTTCAGAGGGGAAAGGG + Intronic
1033998733 7:147385942-147385964 CCTGGATTTCAGAGGATGTATGG - Intronic
1034212159 7:149373310-149373332 CCTGGATTTCAGAGGTTGTATGG - Intergenic
1034971495 7:155422511-155422533 CCTCATTTTCTGAGGGTCTCTGG - Intergenic
1035308188 7:157946880-157946902 CATGCCTCTCAGAGGGTCTCCGG - Intronic
1037081963 8:14797957-14797979 CCTGGATTTCAGAGGATGTAGGG + Intronic
1037625296 8:20601242-20601264 CCTGCATTTTTGAGGGCCTATGG - Intergenic
1038311287 8:26448366-26448388 CCTGCTGTTCAGAGAGGCTGGGG + Intronic
1039121951 8:34157521-34157543 CCTGGATTTCAGAGGATGTAGGG + Intergenic
1039438484 8:37578260-37578282 CCTCCTTGGCAGAGGGTCCAGGG - Intergenic
1040105401 8:43538712-43538734 CCTGCCTCTCAGAGGGTGTGTGG + Intergenic
1041083805 8:54238477-54238499 ATTGCTTTTCAGAGCCTCTAAGG + Intergenic
1042989248 8:74620481-74620503 CCTAGATTTCAGAGGATCTAGGG - Intronic
1043241221 8:77938000-77938022 CCTGGATTTCAGAGGATGTATGG - Intergenic
1043266284 8:78270978-78271000 CCTGGATTTCAGAGGATGTATGG - Intergenic
1043714697 8:83467270-83467292 CCTCAATTTCAGAGGGTGTATGG + Intergenic
1043841775 8:85114108-85114130 CCTGATTTTCAGGGAGACTATGG - Intronic
1044462234 8:92458816-92458838 CCCGCCTTTCAGAGGGTAAAAGG + Intergenic
1046358366 8:113117404-113117426 CCTAGATTTCAGAGGGTATATGG + Intronic
1046607620 8:116388897-116388919 TCTGCTTTTCAGATGATGTATGG + Intergenic
1046786473 8:118272142-118272164 CCTGGATTTCAGAGGATGTATGG - Intronic
1048107501 8:131427571-131427593 CCTGGATTTCAGAGGATGTATGG - Intergenic
1049449133 8:142649696-142649718 CCTAGGTTTCAGAGGGTGTATGG + Intergenic
1050849307 9:10264074-10264096 CCTAGTTTTCAGAGGATATATGG + Intronic
1052701333 9:31941457-31941479 CCTACATTTCAGAGGATGTATGG + Intergenic
1052705399 9:31988580-31988602 CCTGGATTTCAGAGGATGTATGG - Intergenic
1052893937 9:33730245-33730267 CCTGCTTTTCAAAAGAGCTAGGG - Intergenic
1053125870 9:35580475-35580497 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1053571953 9:39318858-39318880 CCTGGATTTCAGAGGATGTATGG + Intergenic
1053703846 9:40729953-40729975 CCTGGATTTCAGAGGATGTAAGG - Intergenic
1054093507 9:60877569-60877591 CCTGGATTTCAGAGGATGTATGG + Intergenic
1054114990 9:61153489-61153511 CCTGGATTTCAGAGGATGTATGG + Intergenic
1054125192 9:61300153-61300175 CCTGGATTTCAGAGGATGTATGG - Intergenic
1054413929 9:64853562-64853584 CCTGGATTTCAGAGGATGTAAGG - Intergenic
1054592766 9:67029045-67029067 CCTGGATTTCAGAGGATGTATGG - Intergenic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1056539552 9:87559573-87559595 CCTGCTTTTGAGAGCGTCCTGGG - Intronic
1056810382 9:89759150-89759172 TATGCTTTACAGAAGGTCTAGGG + Intergenic
1058292218 9:103256890-103256912 CCTAGATTTCAGAGGGTGTATGG - Intergenic
1058653989 9:107203213-107203235 CCTGCTTTCTGGAGGCTCTAGGG - Intergenic
1059187067 9:112283997-112284019 CCTACATTTCAGAGGATGTATGG + Intronic
1062702557 9:137915057-137915079 CCTGCTTTACAGAGGGGCCCAGG + Intronic
1185800094 X:3002718-3002740 CCTACTATTAAGAGGGTTTAAGG - Intergenic
1187649973 X:21391362-21391384 CCTAGATTTCAGAGGATCTATGG - Intronic
1187739491 X:22340304-22340326 ACTGCTTTTCAGTGGATCAACGG + Intergenic
1187851619 X:23596715-23596737 CTTGGTTTTCAGAAGGTTTAAGG + Intergenic
1188162354 X:26819499-26819521 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1189513592 X:41688080-41688102 CTTCCTTCTCAGAGGTTCTAAGG + Intronic
1190794100 X:53725283-53725305 CCTGGATTTCAGAGGTTGTATGG + Intergenic
1191606898 X:63072117-63072139 CCTGGATTTCAGAGGATGTATGG - Intergenic
1191923216 X:66279301-66279323 CCTGGATTTCAGAGGATGTATGG - Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192032199 X:67525578-67525600 CCTGCTCTTCAGAAGCTCAAAGG + Intergenic
1193226466 X:78989756-78989778 CCTGAATTTCAGAGGATGTATGG + Intergenic
1193506231 X:82348073-82348095 CCTAGATTTCAGAGGGTGTACGG - Intergenic
1193779069 X:85680990-85681012 TATGCTTTTTATAGGGTCTACGG + Intergenic
1193865059 X:86720866-86720888 CCTACATTTCAGAGGATGTATGG - Intronic
1193887948 X:87006511-87006533 CCTGGATTTCAGAGGATGTATGG - Intergenic
1194048639 X:89039426-89039448 TCTGCCTTTCAGAGGATGTATGG + Intergenic
1194194106 X:90870674-90870696 CCTGGATTTCAGAGGATGTATGG + Intergenic
1194500222 X:94673053-94673075 CCTAGATTTCAGAGGGTGTACGG - Intergenic
1194843621 X:98776113-98776135 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1194895292 X:99432584-99432606 CCTGCATTTCAGAGGATGTATGG + Intergenic
1195816777 X:108896761-108896783 CCTACATTTCAGAGGATGTATGG + Intergenic
1196258506 X:113550679-113550701 GCTGCATTTCAAAGGGTATAGGG - Intergenic
1196313495 X:114196573-114196595 CCTATATTTCAGAGGGTGTATGG - Intergenic
1196540384 X:116900431-116900453 CCTGGATTTCAGAGGATGTATGG - Intergenic
1196903524 X:120409913-120409935 CCTAGATTTCAGAGGATCTATGG - Intergenic
1197058932 X:122153901-122153923 CCTGAATTTCAGAGGATGTATGG + Intergenic
1197223147 X:123932452-123932474 CCTACATTTCAGAGGATGTATGG + Intergenic
1198636492 X:138707434-138707456 CCTGCTTTCCAGAGTGCCTCAGG - Intronic
1198941990 X:141966103-141966125 CCTGGATTTCAGAGGATGTATGG + Intergenic
1199020320 X:142870629-142870651 CCTGGGTTTCAGAGGATGTATGG + Intergenic
1200139586 X:153892715-153892737 CCTGGTTTTCAGTAGCTCTAGGG + Intronic
1200540715 Y:4453058-4453080 CCTGGATTTCAGAGGATGTATGG + Intergenic
1201481994 Y:14449902-14449924 TGTCCTTTTCAGAGGGTTTAAGG - Intergenic