ID: 1112429605

View in Genome Browser
Species Human (GRCh38)
Location 13:99339142-99339164
Sequence TGTCTATTAGATATCTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112429605_1112429611 -9 Left 1112429605 13:99339142-99339164 CCCCCCAAGATATCTAATAGACA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1112429611 13:99339156-99339178 TAATAGACACTCCCAAGCTCGGG 0: 1
1: 0
2: 1
3: 3
4: 59
1112429605_1112429610 -10 Left 1112429605 13:99339142-99339164 CCCCCCAAGATATCTAATAGACA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1112429610 13:99339155-99339177 CTAATAGACACTCCCAAGCTCGG 0: 1
1: 1
2: 1
3: 0
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112429605 Original CRISPR TGTCTATTAGATATCTTGGG GGG (reversed) Intronic
903448055 1:23434994-23435016 TGTCTGTCTGATATCTTGGTGGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905470975 1:38191390-38191412 AGTCTATTAGATTTATGGGGAGG - Intergenic
908412158 1:63877774-63877796 TATTTATTAGACATTTTGGGGGG + Intronic
910720466 1:90280639-90280661 TGTCTATCAGATTACTTTGGAGG + Intergenic
913507552 1:119531875-119531897 TGTCTGCCAGTTATCTTGGGTGG - Intergenic
914999189 1:152572711-152572733 TTTCTGTGAGCTATCTTGGGTGG + Intronic
916695010 1:167225568-167225590 GGTCTATTAAACATCTTTGGTGG - Intronic
917238896 1:172925440-172925462 TGTCCATTAGAGCTCTTGAGTGG + Intergenic
918365858 1:183806977-183806999 TCTCTTTTCTATATCTTGGGAGG + Intronic
920763044 1:208804271-208804293 TGTCTTTTAGGTAACATGGGTGG - Intergenic
922214595 1:223510028-223510050 TGTCTACTGGAAAGCTTGGGAGG + Intergenic
924542462 1:244994398-244994420 TGTCTCTTAGCTATCTTAGTAGG - Intronic
1062988683 10:1794894-1794916 TGTCTATAAGATCTCTGGGCTGG - Intergenic
1067036190 10:42919713-42919735 TGTGTATTACCTATTTTGGGGGG + Intergenic
1068647782 10:59487672-59487694 TGTCTCTTAGGTATGTTGGGAGG - Intergenic
1070019175 10:72566859-72566881 TGTTTATTAGAAATGTTGGTAGG - Intronic
1071745699 10:88416574-88416596 AGTCTATTAGATTTCTTTTGAGG + Intronic
1071975265 10:90948970-90948992 TGTCTATTAGATCTCCAGGAAGG + Intergenic
1075241851 10:120786402-120786424 TGCCTAGTAGATAACTAGGGGGG - Intergenic
1075535599 10:123269463-123269485 TGTGTATTACATTTTTTGGGAGG + Intergenic
1091176771 11:133565788-133565810 TTTATATTAGATTTCTTTGGAGG + Intergenic
1094554222 12:31482324-31482346 TGCCTATTAGACATCTTGATGGG - Intronic
1094795321 12:33965347-33965369 TGTCTGTGAGATAACATGGGAGG - Intergenic
1095107957 12:38258453-38258475 TGTCTGTGAGATAACATGGGAGG - Intergenic
1097551923 12:61083677-61083699 TGGCTATTTGATGTCTTGTGTGG - Intergenic
1097564878 12:61254409-61254431 ATTCTATTAGTCATCTTGGGAGG - Intergenic
1098777346 12:74637213-74637235 TGTCCATTTTATATCTTGTGTGG - Intergenic
1099647488 12:85377938-85377960 CAGCTATTAGATATCTTAGGAGG + Intergenic
1100047313 12:90398631-90398653 AGTCAATTACATATCTTGGCAGG + Intergenic
1100074456 12:90762596-90762618 TGTCTATTTGATATCTGTGCTGG - Intergenic
1103436661 12:120932071-120932093 TTTCGATTAAATATCTAGGGTGG - Intergenic
1109732982 13:66440411-66440433 TGTCTTTTAGATTTTTTGGCTGG + Intronic
1112429605 13:99339142-99339164 TGTCTATTAGATATCTTGGGGGG - Intronic
1114962952 14:27918141-27918163 TGTCTATTAAAAAGCTAGGGTGG + Intergenic
1116775065 14:49169686-49169708 TGGCTATTAGAGGTCTTTGGTGG + Intergenic
1117269651 14:54129473-54129495 TCTCCATTAGACTTCTTGGGTGG - Intergenic
1118022482 14:61732331-61732353 TGCCTATCAGTTAACTTGGGAGG + Intronic
1119920896 14:78444974-78444996 CTTGTATTAAATATCTTGGGTGG - Intronic
1121963618 14:98284075-98284097 TGTCCATTTGATATCATGAGAGG - Intergenic
1129456568 15:75679166-75679188 TGTCTATTAGATATCGGCAGAGG - Intronic
1133072097 16:3253515-3253537 TGTCTCTTAAACATTTTGGGGGG - Intronic
1136011844 16:27368480-27368502 TGTCCATTAGATATGCTGTGTGG + Intergenic
1137020041 16:35415753-35415775 TGTCTATTAGGGGTCTTTGGTGG - Intergenic
1140578643 16:76202569-76202591 TATATATTAGATGTGTTGGGCGG + Intergenic
1146042818 17:29472986-29473008 TCTCTATCAGAGTTCTTGGGTGG + Intronic
1147026431 17:37588638-37588660 TCTCTATTCTAAATCTTGGGTGG + Intronic
1148485217 17:47986556-47986578 TGTGGATTTGATGTCTTGGGTGG - Intergenic
1153762803 18:8348092-8348114 TGTCATTTTGATTTCTTGGGTGG - Intronic
1154364305 18:13692391-13692413 TGTCTATTAGGTCCATTGGGTGG - Intronic
1155262045 18:24052582-24052604 TTTCTCTTAGATAACTTTGGTGG + Intronic
1156389611 18:36638313-36638335 TATCTAATAGGCATCTTGGGAGG + Intronic
1157055886 18:44228032-44228054 AGTCTATGAGAAATCTTAGGGGG + Intergenic
1159388895 18:67762461-67762483 TCTCTATCAGAGCTCTTGGGTGG - Intergenic
1164132904 19:22382178-22382200 TGTCTATTAGGTATGCTTGGTGG + Intergenic
1164165913 19:22674549-22674571 TGTCTATTAGGTATGCTTGGTGG - Intergenic
1164701066 19:30284683-30284705 TATGTATTTGATATCTTTGGTGG + Intronic
925709826 2:6727841-6727863 TTTCTATTAGATCACTTAGGAGG - Intergenic
925753558 2:7111173-7111195 TGTCCTTTAGATATCTTGAGGGG + Intergenic
927378187 2:22443503-22443525 TGACTATTAGATATTCTTGGAGG + Intergenic
928673513 2:33626997-33627019 TGACAATTAGTTATTTTGGGAGG + Intergenic
930546776 2:52777766-52777788 TGATTATTAGATATTTTGGTTGG - Intergenic
932920077 2:75902714-75902736 TGACTATTATATATTTTGAGAGG - Intergenic
936542955 2:113366922-113366944 TGTGTATCAAATAGCTTGGGAGG + Intergenic
937490901 2:122366213-122366235 TGTTTATTAGATATCTGTGTGGG + Intergenic
938439339 2:131313621-131313643 TTTATATTAGATATTTTGTGAGG - Intronic
940063841 2:149604170-149604192 TGTCATATAGCTATCTTGGGAGG - Intergenic
943986219 2:194622561-194622583 TGTCAATTAGATATTTTGGCTGG + Intergenic
945648402 2:212530499-212530521 TGCCTAATAGAGATCATGGGTGG - Intronic
945731487 2:213541681-213541703 TGTTTATTATACATCTTGGAAGG - Intronic
945989554 2:216383578-216383600 TCTCTATCAGAGCTCTTGGGTGG - Intergenic
948095707 2:235332554-235332576 TCTATATTAGTTTTCTTGGGTGG - Intergenic
1170330223 20:15201285-15201307 GGTATGTTAGATATCTGGGGAGG - Intronic
1173042552 20:39478077-39478099 TCTCTATTAGAGTTATTGGGAGG + Intergenic
950038837 3:9906574-9906596 TGTCTATTACACAGCTAGGGAGG + Intronic
950744531 3:15076298-15076320 TGTCTATTAGATCTCTTTGTTGG + Intronic
950817942 3:15727067-15727089 TGTCTGTAAGAGCTCTTGGGTGG - Intronic
951386265 3:22046468-22046490 TGTCTAGTAGATTTTTTGGTCGG - Intronic
953447090 3:42977869-42977891 TGTTTAATATATATCTTGTGTGG + Intronic
957908946 3:86596341-86596363 TGTTTATTTTATATCTTTGGGGG - Intergenic
958509511 3:95028563-95028585 TGTCTCTTATAGATCCTGGGTGG - Intergenic
960701227 3:120441232-120441254 TGGCAAACAGATATCTTGGGTGG - Intronic
962400121 3:135051187-135051209 GGACTCTTAGATATCATGGGTGG - Intronic
962689445 3:137879046-137879068 TGTCTATTTGATGTCTTTAGTGG - Intergenic
963609955 3:147454309-147454331 TGTCTATTAGACATCTTATTAGG + Intronic
964051639 3:152401255-152401277 TATCTATAATATAGCTTGGGAGG + Intronic
967715241 3:192755007-192755029 TTTCTATTTCATATCTTGAGGGG + Intronic
973035511 4:45401205-45401227 TGTCTACTGGCTATTTTGGGAGG - Intergenic
973699400 4:53521620-53521642 TTTCTTTTAAATATATTGGGAGG - Intronic
975751227 4:77525542-77525564 TGTCTATTAGCTCTCATGGCTGG + Intronic
976568888 4:86585788-86585810 TGTCTAGTAGAAAACTTAGGAGG - Intronic
979583061 4:122382713-122382735 TGTATATTACACATCTTGGCTGG - Intronic
979722990 4:123924842-123924864 TGTCTATTAATTACCTAGGGTGG - Intergenic
979729366 4:124005408-124005430 TTTCCATTGGAGATCTTGGGTGG + Intergenic
980478543 4:133354284-133354306 TATCTAGTATATATTTTGGGAGG + Intergenic
981394031 4:144224965-144224987 TGTTTATTAGATTTGTTGGTAGG + Intergenic
982116201 4:152100234-152100256 TATCTATTATATAGATTGGGGGG + Intergenic
984226243 4:177038596-177038618 TTTCTATGAGATATTTTGGCTGG - Intergenic
993353981 5:86883083-86883105 TGTCTACAAGATATCTTGGAGGG + Intergenic
996020322 5:118583861-118583883 TGTGTATTAGCTAACCTGGGGGG + Intergenic
1000116207 5:158155907-158155929 TGTCAATTAGGTCTCTTTGGTGG - Intergenic
1003363256 6:5448952-5448974 TGTCTATAAGACATCTAGGTAGG + Intronic
1004373277 6:15071055-15071077 TATCTCTTAGGTATGTTGGGAGG + Intergenic
1004757556 6:18629266-18629288 TGTTTATTAGATAACTTAAGAGG + Intergenic
1005353028 6:24955092-24955114 TCTGGATTAGATATTTTGGGAGG + Intronic
1006222568 6:32505264-32505286 TGTCTATTAGATCTTATTGGTGG + Intergenic
1011415533 6:87115988-87116010 TGTCTGTTGGATATGTTGCGGGG + Intergenic
1011874905 6:91946898-91946920 TATCTATAAAATATCTTGGTGGG - Intergenic
1012392686 6:98760984-98761006 TTTCTATCAGAGCTCTTGGGTGG - Intergenic
1012777357 6:103514668-103514690 TGACTAATAGATATATTGAGAGG - Intergenic
1018526339 6:164713888-164713910 TCTCTATCAGATAACTTGAGGGG - Intergenic
1021819558 7:24482842-24482864 AATATATTAGATAGCTTGGGAGG + Intergenic
1024433959 7:49326972-49326994 TGTCAATTAGATATTTTGGCTGG - Intergenic
1028247335 7:88496724-88496746 TGTCTTTTAAATATTTTGTGTGG + Intergenic
1029620891 7:101689108-101689130 CGTCTAATAGACATGTTGGGAGG - Intergenic
1030993098 7:116325030-116325052 TCTCTATCAGAGCTCTTGGGTGG - Intronic
1031232680 7:119129564-119129586 TGTTTATTAGATCTATTGTGGGG + Intergenic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1037931241 8:22881533-22881555 TGTCTATTAGATACCTGGCATGG - Intronic
1039375980 8:37034602-37034624 TGTGTATAAGAGCTCTTGGGAGG + Intergenic
1039816448 8:41098771-41098793 TTTCAATTATATATCTTGGTGGG + Intergenic
1041415658 8:57605557-57605579 TGTCTCTTAGGTATATTAGGAGG + Intergenic
1042325845 8:67526920-67526942 TATCTAATAGGTTTCTTGGGGGG - Intronic
1043097169 8:75989737-75989759 TGTCTACAAGATATCTTTGCAGG - Intergenic
1044845222 8:96373710-96373732 TTTCTATTAGAGCTCTTGGTGGG + Intergenic
1056333999 9:85548021-85548043 TGTTTATTTGATATTTTGTGTGG - Intronic
1060350873 9:122858752-122858774 TGTCTATCAGACATCTTTGCGGG - Exonic
1186544962 X:10439513-10439535 TGTCTATAGGATTTCTTGAGAGG + Intergenic
1188057551 X:25559084-25559106 TGTCTATGAATTATCTTTGGAGG + Intergenic
1188157422 X:26756750-26756772 TGTCTACTGGTTATTTTGGGAGG - Intergenic
1188385207 X:29549017-29549039 TGTCTATTGGAATTCTTGGCGGG + Intronic
1196642261 X:118075750-118075772 TGTCTAGTAGATAACTTGGATGG - Intronic
1197144794 X:123159557-123159579 TCTCTATTAGTTTTCCTGGGAGG - Intergenic
1198414577 X:136406988-136407010 TGCCTATTAAAAATATTGGGGGG + Intronic