ID: 1112433174

View in Genome Browser
Species Human (GRCh38)
Location 13:99370799-99370821
Sequence CAGGATTAACAGGTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112433163_1112433174 28 Left 1112433163 13:99370748-99370770 CCCCTCCCGCTTGCCACTTCTCC 0: 1
1: 0
2: 0
3: 34
4: 576
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138
1112433164_1112433174 27 Left 1112433164 13:99370749-99370771 CCCTCCCGCTTGCCACTTCTCCA 0: 1
1: 0
2: 2
3: 27
4: 269
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138
1112433165_1112433174 26 Left 1112433165 13:99370750-99370772 CCTCCCGCTTGCCACTTCTCCAC 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138
1112433166_1112433174 23 Left 1112433166 13:99370753-99370775 CCCGCTTGCCACTTCTCCACTCA 0: 1
1: 0
2: 0
3: 28
4: 243
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138
1112433168_1112433174 15 Left 1112433168 13:99370761-99370783 CCACTTCTCCACTCAGACTGATG 0: 1
1: 0
2: 0
3: 19
4: 218
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138
1112433170_1112433174 7 Left 1112433170 13:99370769-99370791 CCACTCAGACTGATGGTTTCAGC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138
1112433167_1112433174 22 Left 1112433167 13:99370754-99370776 CCGCTTGCCACTTCTCCACTCAG 0: 1
1: 0
2: 3
3: 22
4: 330
Right 1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG 0: 1
1: 0
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112433174 Original CRISPR CAGGATTAACAGGTGGAGTA TGG Intronic
900940721 1:5796886-5796908 GAGGAATGACAGGTGGAGGAAGG + Intergenic
904364636 1:30002529-30002551 CAGGTTTGAGGGGTGGAGTATGG - Intergenic
904467213 1:30715314-30715336 CAGGAGGAACAGGAGAAGTAAGG + Intronic
910015856 1:82522298-82522320 CAGTATTAACAGTAGCAGTATGG + Intergenic
911100370 1:94091022-94091044 CAGGAATTCCAGGTGGAGAAAGG + Intronic
911904806 1:103553383-103553405 CTGGATCAACAGGTGGGGGAAGG - Exonic
916977630 1:170098683-170098705 CAGCATTACCAGGTTGAGTTTGG - Intergenic
917101518 1:171450739-171450761 GAGGATGAAAAGGTGGAGCAAGG + Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
918385907 1:184007087-184007109 CAGCATTAAAATGTGCAGTATGG + Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
924518486 1:244785776-244785798 GAGTATTAACAAGTGGAGTATGG - Intergenic
1065252341 10:23828315-23828337 CAGCAATAGCAGATGGAGTAGGG + Intronic
1065415768 10:25483730-25483752 ATAGATTAACATGTGGAGTATGG + Intronic
1066174949 10:32893663-32893685 GAGGATTCACATGTGGAGTCAGG + Intergenic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1077895827 11:6452528-6452550 CAGGACTAAGAGATGGAGTTGGG - Intronic
1079385377 11:19974293-19974315 AAGGATGAATAGGTGGAGCATGG + Intronic
1080606347 11:33868503-33868525 CAGCGTTAACATGGGGAGTAAGG - Intronic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1089167804 11:116490676-116490698 AAGAATTAACAGGTGGGGTGTGG - Intergenic
1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG + Intronic
1092993460 12:13925693-13925715 CAGGAATGAAAGGTGGAGTAAGG - Intronic
1096893701 12:54798117-54798139 CAGGAATAACGGGTGGGGTAAGG - Intergenic
1098662521 12:73114385-73114407 CAGCTTTAGCAGGTGGACTATGG - Intergenic
1100959757 12:99949392-99949414 CAGGATCAACATTTGGAGAATGG + Intronic
1102644476 12:114395266-114395288 TTGGATTGACAGGTGGTGTAGGG + Intronic
1103281114 12:119758740-119758762 CAGGAGTAACAGGGGCAGTGCGG + Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1112105051 13:96231189-96231211 CAGGATCAACAGGCACAGTAAGG - Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1112639663 13:101258536-101258558 CAGGATGAACATGTGGAAAACGG + Exonic
1112935797 13:104796846-104796868 CAGGATCAACATGTGGACAATGG + Intergenic
1114646371 14:24258734-24258756 CAGGAGTATCAGGGGGAGAAGGG + Intronic
1114708289 14:24750190-24750212 TAGAACTAACAGGTGGAGAAAGG + Intergenic
1115348338 14:32366201-32366223 CAGGATGAACAGGGGAATTATGG - Intronic
1116083951 14:40210856-40210878 TAGGATAAACAGGTTGAGTCTGG - Intergenic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1123134182 14:106012106-106012128 CAGTAGTAACTGGTGGAGTTGGG - Intergenic
1128479091 15:68022074-68022096 CTGGATTAACAGGGAGAGCAAGG + Intergenic
1129790061 15:78335176-78335198 CAGGATCAACAGGTTGAGTTTGG - Intergenic
1130931941 15:88435767-88435789 CAGGATTAACAGATGTGGTCGGG - Intergenic
1135548805 16:23382916-23382938 GAGGCTTAAGAGGTGAAGTAAGG + Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1141702933 16:85650698-85650720 CTGGATTAGCAGGTGATGTACGG + Intronic
1142962803 17:3561569-3561591 ACGGATTAATAGGTGGAGGATGG + Intergenic
1145249436 17:21289309-21289331 CAGCATTAACAGGACGAATATGG + Intronic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1149814074 17:59706335-59706357 AAAGATTAACGGGTGGAGCATGG - Intronic
1150411173 17:64941765-64941787 CAGGATAAAGGGGTGGAGAAAGG - Intergenic
1150630087 17:66874199-66874221 CAGGATTAAAATGGGGAGTAAGG + Intronic
1151283196 17:73091883-73091905 CAGGTTTAAAAGGGGGAGAAAGG - Intronic
1151338081 17:73452033-73452055 CTGGATTAACAGGAGCAGTGGGG - Intronic
1151636335 17:75351081-75351103 CAGGAAGATCAGGTGGAGAAGGG + Intronic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1153634659 18:7103497-7103519 CAGGATTTAAAGGTGGAACAAGG - Intronic
1155680616 18:28481762-28481784 CAGGATTAACAGTGGCAGCATGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1159745105 18:72223736-72223758 CAGAAATAACTTGTGGAGTAAGG - Intergenic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
927203093 2:20590562-20590584 CATGAGGAAGAGGTGGAGTACGG - Intronic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928142164 2:28739308-28739330 CAGGATTCACAGGGGGACAAAGG - Intergenic
932289736 2:70566730-70566752 TAGAATTAAAAGGTGGAGGAAGG + Intergenic
933593380 2:84258283-84258305 CAGCATTAAGAGCTGGAATATGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940294061 2:152104283-152104305 CAGGTTGAATAGGTGGAGCATGG + Intergenic
941039271 2:160602144-160602166 CAGCTTTAGCAGGTGGAATAAGG - Intergenic
943143860 2:184017567-184017589 CTGGATTAACAGGAAGAGTTTGG + Intergenic
948763016 2:240204252-240204274 CAGCATTACCAGGGGGAGTCGGG - Intergenic
1169203167 20:3725023-3725045 AAGGATGAATAGGTGGAGCACGG + Intergenic
1175632559 20:60554517-60554539 CAGGATTCACGGGTGACGTATGG + Intergenic
1178594959 21:33945012-33945034 CAGGATCAACAGGCAGAGCACGG + Intergenic
1179523785 21:41962348-41962370 CAGGATTAAAAGGTGAAGTCAGG + Intergenic
1182549142 22:31091628-31091650 CAGGAGGATCAGGTGGAGTGAGG - Intronic
952918205 3:38265721-38265743 GAGGAGTGACAGGTGGAGCAGGG + Intergenic
953342194 3:42144105-42144127 CAGGAGTGACAGGTGGGGTGAGG - Intronic
955444556 3:58995733-58995755 CAGAATAAAATGGTGGAGTAAGG + Intronic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
956935571 3:74096946-74096968 CAGGATGAAAAGGAAGAGTAAGG + Intergenic
957027185 3:75195253-75195275 CAGGATGCTCAGGTGTAGTAAGG - Intergenic
957953592 3:87155046-87155068 CAGGATTAACAGGTTCAATAAGG + Intergenic
958595608 3:96217748-96217770 CAGGATTAACAGTGGCAGCATGG + Intergenic
960025020 3:112998864-112998886 CAGGAATATCTGGTGGATTAAGG + Intronic
961114916 3:124320895-124320917 CAGCATTAACAGCTATAGTAGGG + Intronic
962153865 3:132923305-132923327 CAGGATAAACATGTGTAGAAGGG + Intergenic
962159287 3:132981849-132981871 CAGCATTAGCAAGTGGAGTGTGG - Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965358268 3:167705172-167705194 CTGAATTAACATGTGTAGTAAGG - Intronic
967792524 3:193564505-193564527 TAGGATTAACAGGTGGAAACTGG + Intronic
969075217 4:4572824-4572846 CAGGTGGGACAGGTGGAGTAAGG - Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
980990012 4:139731037-139731059 AAGGATTAACAGGTGAGGTCAGG - Intronic
981325138 4:143437734-143437756 CAGATTTAATAGGTGGAGTTGGG + Intronic
982544322 4:156713989-156714011 CAGGACTAAAAGGTGGGGCATGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
990439349 5:55829253-55829275 CAGGTTTAACAGTTGGATTTGGG - Intergenic
991559749 5:67937346-67937368 CAGGAGTAACAAGTGGATTTGGG - Intergenic
994961146 5:106604445-106604467 CAGGAATTGCAGGTGCAGTAGGG + Intergenic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1002553533 5:180016243-180016265 CAGGCTTTAGGGGTGGAGTATGG - Intronic
1003285393 6:4729619-4729641 TAGGATTAAAAGGTGGAGGCTGG + Intronic
1008132241 6:47732105-47732127 CAGGATTATCATTTGGTGTAGGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013911852 6:115284997-115285019 CAGGATCATGAGGTGTAGTATGG + Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017375812 6:153766732-153766754 CAGGAATTACAGGAGCAGTAGGG - Intergenic
1021055996 7:16046938-16046960 AAAGATGAACAGGTGGAGTAGGG + Intergenic
1021542797 7:21778698-21778720 CAGCACTAACAGGTTAAGTAGGG - Intronic
1021860289 7:24899282-24899304 CAGTATTAACAGTTGCAGTGTGG - Intronic
1021864261 7:24939372-24939394 CAGGATTTACAGCTGGGGTTGGG - Intronic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024644679 7:51361192-51361214 CATGACAAAAAGGTGGAGTAGGG - Intergenic
1026631200 7:72039700-72039722 CAGGCTTAGAAGGAGGAGTAAGG + Intronic
1028959768 7:96735574-96735596 CAGGATGAACAGGTAGATGATGG - Intergenic
1032435241 7:131895467-131895489 CAGGAATAACAGCAGGTGTAGGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033560565 7:142526756-142526778 CAGGATTATCAGGAGTAGAAGGG + Intergenic
1035725938 8:1824659-1824681 CAGGGTAAACAGGTGGGGTGCGG - Intronic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1041158162 8:55009353-55009375 CAGGATTAAAAGGTAGAGAGAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041452122 8:58016631-58016653 CAGGATGAATACGTGGAGTTGGG - Intronic
1042074971 8:64983309-64983331 CATGAATAACAGGTTGAGGAAGG - Intergenic
1042801931 8:72728367-72728389 CAGGATTAACAGGAATAGGATGG - Intronic
1044756673 8:95469902-95469924 GAGGATTACCAGGTGGTGAAAGG + Intergenic
1046756549 8:117978552-117978574 GAGGATTATGAGGTGGAGTAGGG + Intronic
1048163692 8:132043286-132043308 CAGGGTTAACAGGAGGCCTATGG - Intronic
1050086025 9:1966617-1966639 AAGGGCTAACAGTTGGAGTAGGG - Intergenic
1056279348 9:85025540-85025562 CAGGATTACCTGGTCAAGTATGG + Exonic
1056329665 9:85511037-85511059 CAGGAAGAACAGCTGCAGTATGG - Intergenic
1057498097 9:95575849-95575871 CAGGAAGCACAGGTGGAGTGGGG + Intergenic
1060874124 9:127067845-127067867 CAGGCTTAAAAGGAGGAGTTCGG - Intronic
1060877222 9:127092074-127092096 AGAGATTAAGAGGTGGAGTAGGG - Intronic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1195757360 X:108212525-108212547 CAGGATTAGTATGTGGGGTAGGG + Intronic
1196009327 X:110870332-110870354 CAGGATTGACAGATGGCATAGGG + Intergenic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1198272450 X:135067355-135067377 CAGGATTAACAGTGGCAGCATGG - Intergenic