ID: 1112434986

View in Genome Browser
Species Human (GRCh38)
Location 13:99385430-99385452
Sequence CTGATGTTCTTGTGGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 337}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112434982_1112434986 -7 Left 1112434982 13:99385414-99385436 CCGAGCATCTCTGGTGCTGATGT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337
1112434975_1112434986 17 Left 1112434975 13:99385390-99385412 CCCACCATCAGATCAGCCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337
1112434977_1112434986 16 Left 1112434977 13:99385391-99385413 CCACCATCAGATCAGCCCGGGGA 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337
1112434973_1112434986 18 Left 1112434973 13:99385389-99385411 CCCCACCATCAGATCAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 93
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337
1112434978_1112434986 13 Left 1112434978 13:99385394-99385416 CCATCAGATCAGCCCGGGGACCG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337
1112434980_1112434986 1 Left 1112434980 13:99385406-99385428 CCCGGGGACCGAGCATCTCTGGT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337
1112434981_1112434986 0 Left 1112434981 13:99385407-99385429 CCGGGGACCGAGCATCTCTGGTG 0: 1
1: 0
2: 0
3: 13
4: 99
Right 1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG 0: 1
1: 0
2: 2
3: 37
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112434986 Original CRISPR CTGATGTTCTTGTGGGAAGA GGG Exonic
901143332 1:7049906-7049928 CTGATGTTCTGGTGGGAGGAGGG + Intronic
901169521 1:7246506-7246528 CTGCTCTTCTTGTGGGGAGGGGG + Intronic
902600617 1:17538470-17538492 CTTATGTTCTTGTGTCGAGAGGG + Intergenic
905493630 1:38365262-38365284 GCAATGTGCTTGTGGGAAGAAGG - Intergenic
905786156 1:40759360-40759382 CTGATGTTCTGGTGGAGACAAGG - Intronic
906093911 1:43207043-43207065 CTGATGTTATCTTGGGAAGAAGG - Intronic
906187596 1:43872712-43872734 CTCATATTCTAGTGGGAAGCAGG + Intronic
907918277 1:58890497-58890519 CTTATATTCTTATGGGAAGACGG + Intergenic
908816823 1:68043497-68043519 CTGATGTTATTGCGGTAAGTGGG + Intergenic
909697241 1:78481537-78481559 CTGAGGTTTTTATGAGAAGACGG + Intronic
910240873 1:85085014-85085036 CTGGTGTCCTTGTGATAAGATGG + Intronic
912472677 1:109916368-109916390 CTGATGTTTTTGGGAGAAGGAGG - Intronic
915886689 1:159729964-159729986 CTGGTGTTCTCATAGGAAGATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
918645659 1:186901685-186901707 CTGATGTCCATGTAGGAAAAAGG + Intronic
919268142 1:195300849-195300871 CTGATTTCCTGGTGGGAAAAAGG + Intergenic
920650197 1:207831847-207831869 CTGCTGCTCTTGTGGGCAGGAGG + Intergenic
923000279 1:230001476-230001498 CTGGTGTCCTTGTAAGAAGATGG - Intergenic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
924104516 1:240636932-240636954 CTGATGTTCTTGTAGTACAACGG + Intergenic
924425839 1:243949569-243949591 CTGGTGTTCTTATAAGAAGAAGG + Intergenic
1063323839 10:5077427-5077449 ATGATGTTCTTGTGGGAAACTGG + Intronic
1063877036 10:10490776-10490798 TTGGTATTCATGTGGGAAGAAGG - Intergenic
1065278675 10:24112890-24112912 CTGGTGTTCTTATAAGAAGAAGG + Intronic
1065506157 10:26432084-26432106 CTGTTTTCCTTGTGAGAAGAAGG - Intergenic
1065941073 10:30564309-30564331 CTGGTGGTATTGTGGAAAGAGGG + Intergenic
1066447406 10:35496319-35496341 GTGATGTTCTTGTTGGAGGGCGG + Intronic
1067215534 10:44299723-44299745 CTGATGTCCTTCTAAGAAGATGG - Intergenic
1067806549 10:49397038-49397060 CTGATTTTATTTTGGGACGATGG + Intergenic
1068032011 10:51716172-51716194 CTGCTGCTCTTGTGGGGAGTGGG + Intronic
1068664274 10:59656544-59656566 GACATGTTCTTGTGGGATGAAGG - Intronic
1069268774 10:66497014-66497036 CTGATGTCCTTGCAAGAAGAGGG - Intronic
1069643556 10:69973524-69973546 CTGATGGTCTCAGGGGAAGATGG - Intergenic
1070761143 10:79025105-79025127 CTGATGTTCATGCAGGGAGAAGG + Intergenic
1070888856 10:79927390-79927412 CTGATGGGCTGCTGGGAAGAGGG + Intergenic
1071845298 10:89515576-89515598 TTGAGCTTCTTGTGGGAAAACGG - Intronic
1071957927 10:90779345-90779367 CTGATGTGATTGTGAGAAGTGGG + Intronic
1072326899 10:94307692-94307714 CTGGTGTCCTTATGAGAAGAGGG - Intronic
1073308801 10:102524745-102524767 CTTATGTTCTAGTGGGAAGGAGG - Intronic
1073480227 10:103781907-103781929 CTGATGTCCCTGTGGCAAGGAGG - Intronic
1074581625 10:114724691-114724713 CTGCTGTTCTCGTGAGAGGAAGG - Intergenic
1074760318 10:116662872-116662894 CTGGTGTCCTTGTAAGAAGACGG + Intergenic
1075010753 10:118868007-118868029 CTGATGTCCTTCAAGGAAGAAGG + Intergenic
1076690276 10:132220189-132220211 CTGGTGTCCTTATGAGAAGAGGG + Intronic
1079119967 11:17674989-17675011 CTAATGTTCTTGTGAGGACAGGG - Intergenic
1079122173 11:17693973-17693995 CTGATGTTGATCTGGGGAGAGGG + Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1083980325 11:66162421-66162443 CTGATGTTCTTATAAGAGGAAGG + Intronic
1084400676 11:68941178-68941200 ATGATGCTCTTGGGGGATGAGGG + Intergenic
1084672173 11:70613734-70613756 CTGCTGTCCTTGTAAGAAGAGGG + Intronic
1085795966 11:79540169-79540191 CTGGTGTCCTTTTGAGAAGAGGG + Intergenic
1086065705 11:82742095-82742117 CTGATGTTCTTATGATTAGATGG - Intergenic
1086403202 11:86477905-86477927 CTGTTGTTCTTCTGAGAACATGG + Intronic
1088164352 11:106914863-106914885 CTTTTTTTCTTGTTGGAAGATGG - Intronic
1088212274 11:107469895-107469917 CTTATATTCTAGTGGAAAGAAGG + Intergenic
1089082399 11:115787914-115787936 CTGCTGACCTTGGGGGAAGAAGG + Intergenic
1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG + Intronic
1090644444 11:128756375-128756397 CTGGTGTTCTTATAAGAAGAGGG - Intronic
1090725908 11:129527028-129527050 TTGATGGTCCTTTGGGAAGATGG - Intergenic
1090735052 11:129605515-129605537 CTGAGGTTCCTGTGGGTATAAGG + Intergenic
1093828860 12:23730448-23730470 GACATGTTCTTGAGGGAAGATGG + Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094865151 12:34523040-34523062 CTGGTGTTCAAGTGTGAAGAAGG - Intergenic
1095040711 12:37437178-37437200 CTGATATTCTTTTGGCAAGCTGG + Intergenic
1095267391 12:40176150-40176172 CTGGTGTACTTGTAAGAAGAGGG + Intergenic
1095774658 12:45999253-45999275 CTGATGTCCTTATAGGAAGAGGG + Intergenic
1098020448 12:66150147-66150169 CTGATTTCTGTGTGGGAAGAGGG - Intronic
1099462184 12:82937399-82937421 CTGATGTCCTTTTAAGAAGATGG - Intronic
1099543629 12:83947842-83947864 ATGTTGTTCTTAGGGGAAGAAGG + Intergenic
1099555846 12:84107593-84107615 CTGGTGTTCACGTGTGAAGAAGG + Intergenic
1100029536 12:90169022-90169044 CTGAACTTGATGTGGGAAGAAGG - Intergenic
1101435507 12:104660691-104660713 CGGATTTTCTTCTGAGAAGAAGG - Intronic
1104826293 12:131711594-131711616 CTGGTGTTCTGGTGGGGAGGGGG + Intronic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1106907146 13:34420926-34420948 GTGATGTTCTTATAAGAAGAGGG - Intergenic
1107040532 13:35943145-35943167 CTGGTGTCCTTATGAGAAGAGGG + Intronic
1107716483 13:43204643-43204665 CTGATGTCCTTGTGGGTTAACGG + Intergenic
1108611323 13:52086790-52086812 CTGATGTCCTTGCAAGAAGATGG + Intronic
1108775617 13:53761701-53761723 CTGATGTGTTTGTGTGAAGATGG + Intergenic
1110835566 13:80078294-80078316 CTCATGTGATTGTGGTAAGATGG + Intergenic
1111775359 13:92654908-92654930 CTGATGTTCTTATAAGAAGAGGG + Intronic
1111800038 13:92969902-92969924 CTGGTGAACATGTGGGAAGAAGG + Intergenic
1112121728 13:96419833-96419855 CTGGTGTCCTTATAGGAAGAGGG - Intronic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113263311 13:108590612-108590634 CTGATGTTCTTATGAGAGGAGGG + Intergenic
1113339338 13:109406717-109406739 CTAATGTGTTTGTGGAAAGAGGG - Intergenic
1114577641 14:23728488-23728510 CTCATGCCCTTGTGGGCAGATGG - Intergenic
1117881600 14:60318121-60318143 CTGGTGCTGTTATGGGAAGATGG - Intergenic
1118039661 14:61903116-61903138 CTGATGTCCTTATAAGAAGATGG - Intergenic
1118087432 14:62433856-62433878 CTGGTGTTCTTATAAGAAGATGG - Intergenic
1118440971 14:65811489-65811511 CTGATTTTCTTGTCTGAAAATGG - Intergenic
1118810354 14:69268660-69268682 CTCATATTCTAGTGGGGAGAGGG + Intronic
1119844269 14:77816790-77816812 CTGATGTTGTGGGGGGAAGTGGG + Intronic
1120143067 14:80950075-80950097 CTGATGTCCTTGTAGGAAGAGGG + Intronic
1120465827 14:84855952-84855974 CTGATGTTCTTAGAAGAAGAGGG + Intergenic
1120748739 14:88177664-88177686 CTGGTGCTCTTGTGGAATGATGG + Intergenic
1121754834 14:96393633-96393655 CTGGTGTCCTTATGAGAAGAGGG - Intronic
1121796156 14:96737096-96737118 CTGATGTTCATGTGAGCAGAAGG + Intergenic
1121797683 14:96748732-96748754 AAGATGTTCTTCTGGAAAGAGGG + Intergenic
1124235786 15:27988450-27988472 CTGATGTCCTTATAGGATGAGGG + Intronic
1124969117 15:34467613-34467635 CTGATGTTCTTATAAGAAGAGGG + Intergenic
1127016661 15:54696295-54696317 CTGATTTTTTCGGGGGAAGATGG + Intergenic
1127283030 15:57508323-57508345 CTGATGTTCTTCTTGGAGCATGG + Intronic
1127979014 15:64020736-64020758 CTGAGGTGCTTTTGGGAACAGGG - Intronic
1128221343 15:65970782-65970804 CTGAACTTCTTCTGGGAAGTTGG - Intronic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1130763667 15:86848184-86848206 CTGAACTTCTGGTGGGAAAATGG - Intronic
1131088098 15:89595375-89595397 CTGATGTTGTTTTGGTAGGAGGG + Exonic
1132190165 15:99847804-99847826 CAGATGTTCTTATAAGAAGAGGG - Intergenic
1133902695 16:9992341-9992363 CTGATGTTCCCATGTGAAGATGG + Intronic
1134901570 16:17942829-17942851 CTCCTGGTCCTGTGGGAAGAAGG - Intergenic
1135406085 16:22198939-22198961 CTTAAGTTCATGTGGCAAGATGG - Intergenic
1136155694 16:28380525-28380547 TGGATCTTCCTGTGGGAAGAGGG + Exonic
1136207390 16:28734764-28734786 TGGATCTTCCTGTGGGAAGAGGG - Exonic
1136593050 16:31229240-31229262 CTGCTGTTCGTGTGGGAGGGAGG + Intergenic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1141243633 16:82286360-82286382 CTAATGTTGATGTGGGAAAATGG - Intergenic
1141617243 16:85216973-85216995 CTGATGCTTGTGTGGGATGAAGG + Intergenic
1141703484 16:85652807-85652829 CTGCTGATCTTGTGGGGAGACGG + Intronic
1141924329 16:87157421-87157443 CTGGTGTGCTAATGGGAAGAAGG + Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144232319 17:13220471-13220493 CTGCTGGGCTTCTGGGAAGAGGG + Intergenic
1145377126 17:22361187-22361209 CTGATATTCTTTGGGGAAGCTGG - Intergenic
1146507321 17:33416621-33416643 GTGATGCCGTTGTGGGAAGATGG + Intronic
1146916036 17:36679098-36679120 CTGAAGGTCACGTGGGAAGACGG + Intergenic
1148994948 17:51701292-51701314 CTGGTGTCCTTATGAGAAGAGGG - Intronic
1149900035 17:60467562-60467584 CTTATGTTCTAGTGGTGAGAAGG + Intronic
1151254902 17:72869098-72869120 CAGAGGTTCTTCTGGGAATAAGG + Intronic
1151336282 17:73441486-73441508 CTGGTGTCCTTGTAAGAAGAGGG + Intronic
1151595326 17:75074890-75074912 CTGATGTGTTTGTGGGTGGAGGG - Intergenic
1153210404 18:2756480-2756502 CTGGTGTTTTTGTGGGGGGAAGG + Intronic
1154160252 18:11976052-11976074 CTGGTGTTCTTATGAAAAGAGGG - Intergenic
1156253433 18:35373966-35373988 CTGAAGCTCTTTTGGGAGGATGG + Exonic
1156716601 18:40020195-40020217 CTCATGTTCTTGTCTAAAGATGG - Intergenic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1157154501 18:45252591-45252613 CTGAAGTTCTTGTCAGAATAAGG - Intronic
1157924425 18:51747591-51747613 CTGATGTTCATCAGGGATGATGG + Intergenic
1158694401 18:59690783-59690805 CACCTGTTCTTGTGGGAAGGCGG + Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159832480 18:73294230-73294252 CTAATCTTTTTGTGGGAAGCTGG - Intergenic
1160113801 18:76058362-76058384 GTGATGTTCTCGTGGGAACAAGG + Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1162879590 19:13648320-13648342 CAGATATTCATTTGGGAAGATGG - Intergenic
1164378552 19:27711352-27711374 CTGTTGTTCAAGTGTGAAGAAGG + Intergenic
1164918760 19:32072886-32072908 CTGCTGTGCTGGTGGGAAGCAGG - Intergenic
1168318120 19:55493138-55493160 CTGATGTCCTTTGGGGAGGAAGG - Intronic
925458893 2:4043090-4043112 CTGGTGTCCTTATGAGAAGAGGG + Intergenic
927051216 2:19331170-19331192 CTTGTGTTCTTGTGGGACCATGG + Intergenic
927288088 2:21377838-21377860 GGGATGTTCTTTTGGGAAGGAGG + Intergenic
929547754 2:42866730-42866752 CTGGTGTTCTTGAGCGATGATGG - Intergenic
931157499 2:59652149-59652171 CTGATGTTTTTATAAGAAGAGGG + Intergenic
931188922 2:59980638-59980660 CTGGTGTCCTTGTAAGAAGAGGG - Intergenic
931599646 2:63990527-63990549 CTGGTGTGCATGTGTGAAGAAGG - Intronic
934542566 2:95188252-95188274 CTGGTGTTCTTGTGGGTTGAGGG - Intergenic
936273365 2:111069453-111069475 CTGATGTCCTTATAAGAAGAGGG - Intronic
936644333 2:114351159-114351181 TTGCTGTCCTTGTAGGAAGAGGG + Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
938107864 2:128545470-128545492 CTCAGGTTGTTGTGAGAAGAGGG - Intergenic
938320585 2:130359670-130359692 TTCATGTCCTTGTGGGAGGAGGG + Intronic
939999942 2:148957148-148957170 CTGAAGTTCTTTTGGAAACAAGG + Intronic
940032296 2:149276538-149276560 CAGATGTTATTGTGGATAGATGG + Intergenic
941186579 2:162326825-162326847 CTGAGTTTTTTGTGGAAAGAAGG - Intronic
941410100 2:165143888-165143910 AAGATGTTCTAGTGGGAACAAGG + Intronic
942070880 2:172314141-172314163 TTAATGTTCCCGTGGGAAGAAGG - Intergenic
942537846 2:176984261-176984283 CTAATATTCTAGTGGGATGATGG + Intergenic
945130207 2:206562959-206562981 CTGATTTTCTAGTGGGCAAAGGG + Intronic
946282984 2:218679879-218679901 CTGATGTTTCTGTGGGAGGTAGG - Exonic
946585332 2:221180067-221180089 CTGATGTCCTTATGAGAAGAGGG + Intergenic
946716616 2:222559892-222559914 CTGCTGTTCATGTTGGAATAAGG + Exonic
946870119 2:224077267-224077289 ATGCTGTTCTGGTGGGATGATGG - Intergenic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169330096 20:4709572-4709594 CTGGTGTCCTTGTAAGAAGAGGG - Intergenic
1169689852 20:8318304-8318326 CTGATTTTCTAGTGGGAGAAGGG + Intronic
1169738890 20:8868510-8868532 CTGATATTCTTGTGTGTTGAGGG - Intronic
1169864522 20:10185662-10185684 CTGATGTGCTTGTGGTAAGGTGG + Intergenic
1169869145 20:10232890-10232912 CTGATGTTATTGCGGGAAAGGGG - Intronic
1170152934 20:13244275-13244297 CTGGTTTTCATGTGGGCAGAGGG + Intronic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1171526356 20:25814710-25814732 CTGATATTCTTTTGGGAAGCTGG + Intronic
1171535260 20:25881790-25881812 CTGATATTCTTTTGGCAAGCTGG + Intergenic
1171550471 20:26041175-26041197 CTGATATTCTTTTGGGAAGCTGG - Intergenic
1171572594 20:26268106-26268128 CTGATATTCTTTTGGGAAGCTGG - Intergenic
1171838273 20:30177335-30177357 CTGATATTCTTTTGGCAAGCTGG + Intergenic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1172929696 20:38577178-38577200 CAGATGTTATTGTGAGCAGAAGG - Exonic
1173752743 20:45489680-45489702 CTCATCTTCTTGTGGGACCAGGG + Intergenic
1173960955 20:47072171-47072193 CTGTTGTGCCTGTGGGAAGGAGG - Exonic
1174031907 20:47635560-47635582 TTGTTGTTCTGGTAGGAAGATGG - Exonic
1174684869 20:52445016-52445038 CAGGTGATGTTGTGGGAAGAGGG - Intergenic
1175724870 20:61310833-61310855 CTGGTGTCCCTGTGGGAAGAGGG - Intronic
1176271386 20:64236712-64236734 CTTTTGTGCTGGTGGGAAGAAGG + Intronic
1176704367 21:10101049-10101071 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1178704582 21:34862668-34862690 CTGATGTCCTTCTAAGAAGAGGG - Intronic
1179186594 21:39089699-39089721 CTGATGTCCTTATAAGAAGAGGG + Intergenic
1179330009 21:40390747-40390769 CTGGTGTTTTTGTAAGAAGAGGG - Intronic
1180013864 21:45070238-45070260 TTCATGTTCTAGTGGGGAGATGG - Intergenic
1180574663 22:16761375-16761397 CTGATATTCTTTTGGGAAGCTGG + Intergenic
1182109254 22:27711286-27711308 CTGAGGTTCTTGTTGGGGGAGGG - Intergenic
949386738 3:3511246-3511268 CTGATGTTATTCAGGGAATATGG + Intergenic
949619488 3:5794310-5794332 CTTATGTTCTTTTGGCAATAGGG - Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
951088417 3:18542366-18542388 CTGATGTTCGTGGTGGTAGATGG + Intergenic
952551765 3:34486542-34486564 CTGATGTTTTTATGGGAGGATGG + Intergenic
953157706 3:40389821-40389843 CTGTTATTCTTCTGGGAAAATGG + Intronic
953422364 3:42764431-42764453 CTGCTGTCCGTGTGGGACGATGG - Intronic
953429819 3:42829914-42829936 CTGATTTTCTTTTGAGAATAGGG - Intronic
953465362 3:43114985-43115007 GTGATGTTTTCGTGGGGAGAGGG - Intergenic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
954524679 3:51259560-51259582 CAGATGTCTTGGTGGGAAGAGGG + Intronic
956074663 3:65491940-65491962 TTGATGTTCTTTGGAGAAGACGG - Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
959643682 3:108672055-108672077 GTGAAGTTATAGTGGGAAGACGG - Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
961533135 3:127552130-127552152 CTGATATTTCTCTGGGAAGATGG - Intergenic
964471419 3:157060855-157060877 CTGATGTCCTTATAAGAAGAAGG + Intergenic
965622856 3:170658119-170658141 CTGATGTTCTTATAAGAGGAAGG - Intronic
966092142 3:176152835-176152857 CTTATGATTTTGTGGGAATATGG - Intergenic
966586824 3:181635488-181635510 CTTTTGGTCTTGTGGGAAGTAGG - Intergenic
967044349 3:185723119-185723141 CTGAGGTTTATGTGGGAAGTGGG + Intronic
967133959 3:186497449-186497471 TTGATGTTTCTGTGGGTAGATGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967524041 3:190471746-190471768 CTGATGTTCCAGTGGGAATTGGG + Intergenic
969381179 4:6799225-6799247 CTGATGTCCTTATAAGAAGAGGG - Intronic
970036515 4:11741701-11741723 TTTATGTTCTTGTGGGCAGGAGG - Intergenic
970297432 4:14645507-14645529 CTGGTGTCCTTGTAAGAAGAGGG + Intergenic
970763688 4:19521268-19521290 CAGATGTTCTCCTGGGACGATGG - Intergenic
971188712 4:24406254-24406276 CCTAACTTCTTGTGGGAAGATGG - Intergenic
971393534 4:26207684-26207706 CTGATGCTCTGCTGGGGAGAGGG + Intronic
971538676 4:27787033-27787055 CTCATGTTATTGTGGCAAGTTGG - Intergenic
971899979 4:32646765-32646787 CTGGTGTCCATGTGTGAAGAAGG - Intergenic
972736168 4:41843689-41843711 CTTATGTTCTTTCAGGAAGATGG + Intergenic
972883425 4:43454779-43454801 CTTATTTTCTTGTGGTGAGAGGG + Intergenic
973867742 4:55130836-55130858 CTGATGTTCTTAGGCGATGAAGG - Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
975894670 4:79074579-79074601 ATCATGTTCTTGTGGGAACATGG + Intergenic
976960305 4:90963570-90963592 CTGGTGTCCTTGTAAGAAGACGG + Intronic
978027636 4:103896991-103897013 CTGAGGTCCTTTTGGGCAGAAGG - Intergenic
978399165 4:108312857-108312879 CTGATTTTCCTGTTAGAAGATGG - Intergenic
979387917 4:120092018-120092040 CTGATGTGTTTTTGGGAATAAGG + Intergenic
979611365 4:122692228-122692250 CTGATGTCCTTATGAGAAAATGG + Intergenic
980376579 4:131957383-131957405 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
981019008 4:140005646-140005668 CTAATCTTCTTTTGGGAGGATGG - Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981435676 4:144718759-144718781 GTGATTTTCTTGTGGATAGATGG + Intronic
982673867 4:158353081-158353103 CTTATGTTCTAGTGAGAAGAAGG - Intronic
984698854 4:182805847-182805869 CTAGTGTTCGTGTGGGAGGAAGG - Intergenic
984898405 4:184562778-184562800 CTGATATTCTTTTGAGAAGCTGG - Intergenic
986067221 5:4246332-4246354 CTGATGCCCATGTGGGCAGAAGG - Intergenic
987552635 5:19403635-19403657 CTGATGTTCCTGGGGGTGGAAGG + Intergenic
987895073 5:23934066-23934088 CTGATGTCCTTATAGGAAAAAGG + Intergenic
988627391 5:32892213-32892235 TTGGTCTTCTTCTGGGAAGAGGG + Intergenic
990835606 5:60015746-60015768 CTGATGTTCTCAAAGGAAGAGGG + Intronic
992495549 5:77289793-77289815 CCTGTGATCTTGTGGGAAGAGGG + Intronic
992985029 5:82219944-82219966 CTTATATTCTGGTGGGGAGATGG + Intronic
993691977 5:91013029-91013051 GTGTTTTTCTTGTGGGAACAAGG - Intronic
994509403 5:100684692-100684714 TTGTGGTTCTTGTGGGAAAAAGG - Intergenic
996290280 5:121844571-121844593 CTGATGTCCTTATAAGAAGAGGG - Intergenic
1000477550 5:161730024-161730046 GTGATGTTCTTGAGGGTTGAGGG + Intergenic
1001679517 5:173545918-173545940 ATGAGCTCCTTGTGGGAAGAGGG - Intergenic
1001697865 5:173685779-173685801 TGGATGTTCTTTTGAGAAGATGG - Intergenic
1001778283 5:174345439-174345461 CTGGTGTTCTTTTAAGAAGAAGG - Intergenic
1001891149 5:175340017-175340039 CTGATGAGGTTGTGGGAAAAAGG + Intergenic
1002032513 5:176441024-176441046 ATGCTGTTCTTGTGGGAGGGAGG - Intergenic
1002517117 5:179766823-179766845 CCGAGGTAGTTGTGGGAAGAGGG + Intronic
1002850785 6:995038-995060 GTGATGTACTTGTGATAAGAGGG - Intergenic
1003678921 6:8232888-8232910 GTCATTTTCTTGTGGCAAGAGGG + Intergenic
1003957994 6:11183515-11183537 GAAATGTTCATGTGGGAAGAGGG - Exonic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1006454512 6:34124123-34124145 CTGATCTTCTTGCTGGCAGAGGG - Intronic
1007376643 6:41461437-41461459 CTGATGTCCTTGCTTGAAGAAGG - Intergenic
1007872285 6:45053955-45053977 CTGATGGTCTTCAGGGGAGAAGG - Intronic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1009061359 6:58400960-58400982 CTGGTGTGCATGTGTGAAGAAGG - Intergenic
1010154901 6:72781151-72781173 CTGGTATCCTTGTGAGAAGAGGG + Intronic
1010522169 6:76850406-76850428 TTGATGATCCTGTGGCAAGATGG - Intergenic
1011596606 6:89022542-89022564 TTGCTGTACTTGTGGGGAGATGG - Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013066916 6:106692986-106693008 CTGATTTCCTTGTAAGAAGAGGG + Intergenic
1013122730 6:107155453-107155475 CTGATATTCTTATGTGAGGAAGG + Intronic
1013176379 6:107680817-107680839 CTGCCCTTCTGGTGGGAAGAAGG - Intergenic
1013342012 6:109224217-109224239 CTCATTTTCTTCTGGGAAGTTGG - Intergenic
1014317282 6:119883785-119883807 AGGATATTCTTGGGGGAAGAGGG - Intergenic
1015355522 6:132273094-132273116 CTGATGTTCTTGTAAGAAACTGG + Intergenic
1016586248 6:145689966-145689988 CTGATGGTCGGGTGGGAAGGAGG - Intronic
1016672079 6:146720930-146720952 CTGAAGCTCCTGTGGAAAGAAGG + Intronic
1017038974 6:150292554-150292576 CTCAGCTTCTTGTGTGAAGACGG + Intergenic
1017301689 6:152868503-152868525 CTGTTTTTCATGTGGTAAGAAGG + Intergenic
1017331284 6:153200467-153200489 CTGATGTCCTTGTAACAAGATGG - Intergenic
1017784381 6:157742679-157742701 CTGATGGTCTTTTGGGCCGATGG + Intronic
1018660274 6:166079469-166079491 CTGGTGTCCTTGTAAGAAGAGGG - Intergenic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1019139982 6:169936962-169936984 CTGGTGTCCTTAGGGGAAGAGGG - Intergenic
1020061654 7:5157012-5157034 CTGATGGTCTGATGGGTAGATGG - Intergenic
1020166504 7:5811649-5811671 CTGATGGTCTGATGGGTAGATGG + Intergenic
1020382786 7:7565399-7565421 CTGATGATCTTGGTGGCAGATGG - Intergenic
1020396156 7:7720971-7720993 CTGATGTCCTTATAAGAAGAGGG + Intronic
1021377880 7:19931290-19931312 TCGATGTTCCTGTGGGAAGAGGG + Intergenic
1021551084 7:21871793-21871815 CTGATGTCTTTATGAGAAGAAGG - Intronic
1022070593 7:26909720-26909742 CTGATGTTCTTCTCAGAGGAAGG - Intronic
1022162953 7:27730372-27730394 CTCGTGTTCTTGTAAGAAGAGGG - Intergenic
1022284137 7:28938934-28938956 TTCATGTACTTGTGGGTAGAAGG + Intergenic
1022447395 7:30481420-30481442 CTGATGTTCTTGTGTGCTGGAGG - Intergenic
1023230087 7:38018784-38018806 GGGATGTTCTTTTGGGGAGATGG - Intronic
1023531459 7:41160399-41160421 CTTATGTTCTTGCTGGAAAAGGG - Intergenic
1023552313 7:41383336-41383358 CTGATGTTCTTGTCTGAAGGGGG + Intergenic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1026098493 7:67365576-67365598 CTGATGTTTTTAGGGGCAGATGG + Intergenic
1026196346 7:68177004-68177026 ACGATGATCTTGTAGGAAGAAGG - Intergenic
1026363477 7:69624771-69624793 CTGGTATACTTTTGGGAAGATGG - Intronic
1027440612 7:78215543-78215565 GTGATGATTTTTTGGGAAGAAGG + Intronic
1028684783 7:93579268-93579290 CTTATATTCTAGTGGGAAGAGGG + Intergenic
1030504171 7:110398754-110398776 CTGAAGTTGTTGTGGGAAATGGG + Intergenic
1031040794 7:116836583-116836605 CTGAAGTTCTTGTCTGGAGATGG + Intronic
1032414715 7:131727271-131727293 CTGGCCTTCTTGTGGGAAGTGGG - Intergenic
1032574060 7:133033861-133033883 CTGATGTCCTAGAGGGATGAGGG + Intronic
1032629740 7:133635834-133635856 CTGATATTCTTGTAAGAGGAAGG - Intronic
1032997313 7:137462417-137462439 CTTATTTTCTTGTGTGAAGACGG - Intronic
1033264056 7:139869326-139869348 CTGGTGTCCTTATGAGAAGATGG - Intronic
1034047421 7:147944453-147944475 CAGATGGTCTTGTGAGAAGCAGG - Intronic
1034069092 7:148165266-148165288 CTGGTGTTCTTGTAAGAAGAGGG - Intronic
1037477282 8:19270177-19270199 GAGATGTTCATGTGGGAAGAGGG + Intergenic
1037888159 8:22605922-22605944 CTGATGTTCCTCTGGAAAGCAGG + Intronic
1038143404 8:24870961-24870983 CTGATGTCCTTATCAGAAGAGGG - Intergenic
1039366664 8:36935192-36935214 CTTTTGTTCCAGTGGGAAGAGGG - Intronic
1039480884 8:37872461-37872483 CTGATGCTCCCATGGGAAGAGGG + Exonic
1039665918 8:39527959-39527981 CTGAAGTTCCTGTTGGAGGAAGG - Intergenic
1040747769 8:50666435-50666457 CTAATGTTCTTGTTTGTAGAAGG + Intronic
1040888266 8:52288988-52289010 CTGATGGTCATGTAGGAAAATGG - Intronic
1042163744 8:65924378-65924400 TTGTTCTTCTTGTGAGAAGAAGG + Intergenic
1044593155 8:93933205-93933227 CTCATGTGATTGTTGGAAGAAGG - Intergenic
1045550800 8:103170465-103170487 CTGTTGTTCTTGTAAGAAAAAGG + Intronic
1045889453 8:107137219-107137241 CTGATGTTTTTGTTGGTAGGGGG + Intergenic
1047175244 8:122534735-122534757 CTTATATTCTAGTGGGAAAAGGG + Intergenic
1048450312 8:134527705-134527727 TTGAGGATCCTGTGGGAAGAGGG - Intronic
1048829946 8:138466129-138466151 CTGGAGCTCTTGTTGGAAGAGGG - Intronic
1049242084 8:141543214-141543236 CTGGTGTCCTTATGAGAAGAGGG + Intergenic
1049409919 8:142468353-142468375 CCGTTGGTCTTGTGGAAAGACGG + Intronic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1053163278 9:35828414-35828436 CAGATGTCTTTGAGGGAAGAGGG + Intronic
1053362380 9:37498004-37498026 CTGCTGTTCTCGTTGTAAGAGGG + Intronic
1053584082 9:39437905-39437927 CTGCTGTTTTTGTGGGTGGAAGG - Intergenic
1053641628 9:40088065-40088087 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1053764507 9:41377399-41377421 CTGGTGGACCTGTGGGAAGAGGG + Intergenic
1054105663 9:60996649-60996671 CTGCTGTTTTTGTGGGTGGAAGG - Intergenic
1054322516 9:63685454-63685476 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1054543123 9:66288576-66288598 CTGGTGGACCTGTGGGAAGAGGG + Intergenic
1057397892 9:94696317-94696339 CTTATGTTCTGGTGAGCAGAGGG - Intergenic
1059880712 9:118685892-118685914 CTGGTGTTCTTATAAGAAGATGG + Intergenic
1202789404 9_KI270719v1_random:71151-71173 CTGGTGGACCTGTGGGAAGAGGG - Intergenic
1203769682 EBV:43060-43082 CTGAGGTGAGTGTGGGAAGATGG + Intergenic
1185503475 X:616183-616205 CTGATGTCTTTGGGGGAAAAGGG - Intergenic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186543591 X:10425939-10425961 CTGAGGTTGCTCTGGGAAGAGGG + Intergenic
1186716677 X:12259319-12259341 CTGATGTCTTTATGAGAAGAGGG + Intronic
1187180304 X:16937860-16937882 ATGTTGTTCATGTGGGAATAGGG - Intergenic
1187954274 X:24500658-24500680 CTGATGTTCTTGGTGAAGGAAGG + Intronic
1188297511 X:28468083-28468105 GTGATATTCTTGAGAGAAGAAGG - Intergenic
1188486909 X:30692193-30692215 CTGAAGTTATTGTGGGGGGACGG - Intronic
1190002314 X:46700918-46700940 TTGATGGTGGTGTGGGAAGAGGG - Intronic
1190534510 X:51412263-51412285 CTCATAGTCTAGTGGGAAGATGG - Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1192343740 X:70284289-70284311 GTGAAGTCCTTGTGGAAAGAAGG - Exonic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1194025828 X:88749242-88749264 ATGCTTTTCTTGGGGGAAGAAGG + Intronic
1194626192 X:96229191-96229213 CTTACATTCTAGTGGGAAGAGGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1197683432 X:129411516-129411538 CTGGTGTTCTCATAGGAAGAGGG + Intergenic
1198048909 X:132929920-132929942 CTGATGTCTCTGGGGGAAGAGGG - Intronic
1198263115 X:134984166-134984188 CTGATGTTCTTCTAAGAAGAAGG - Intergenic
1199519722 X:148721916-148721938 CTGATGTCCTTATGAGAAGAGGG - Intronic
1200573936 Y:4865920-4865942 TTGGTGTTTCTGTGGGAAGAAGG - Intergenic
1201712360 Y:17006784-17006806 CAGATGTTCTTCTGGGGAGATGG + Intergenic