ID: 1112436503

View in Genome Browser
Species Human (GRCh38)
Location 13:99394505-99394527
Sequence TACTCACAGCTCCCAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112436503_1112436507 19 Left 1112436503 13:99394505-99394527 CCTCTCCTTGGGAGCTGTGAGTA No data
Right 1112436507 13:99394547-99394569 GTGCTCGGCCGCTGATCTGTTGG No data
1112436503_1112436505 -3 Left 1112436503 13:99394505-99394527 CCTCTCCTTGGGAGCTGTGAGTA No data
Right 1112436505 13:99394525-99394547 GTAACGAACTGTCTTTTCAATGG No data
1112436503_1112436506 4 Left 1112436503 13:99394505-99394527 CCTCTCCTTGGGAGCTGTGAGTA No data
Right 1112436506 13:99394532-99394554 ACTGTCTTTTCAATGGTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112436503 Original CRISPR TACTCACAGCTCCCAAGGAG AGG (reversed) Intergenic
No off target data available for this crispr