ID: 1112441973

View in Genome Browser
Species Human (GRCh38)
Location 13:99431208-99431230
Sequence CTGTTCATTTGGGGCAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112441973_1112441981 21 Left 1112441973 13:99431208-99431230 CCTAGGTTGCCCCAAATGAACAG No data
Right 1112441981 13:99431252-99431274 AGAGGAGATGGTGATAGATATGG No data
1112441973_1112441978 3 Left 1112441973 13:99431208-99431230 CCTAGGTTGCCCCAAATGAACAG No data
Right 1112441978 13:99431234-99431256 TCCAGTGATTGCAGAAAAAGAGG No data
1112441973_1112441980 9 Left 1112441973 13:99431208-99431230 CCTAGGTTGCCCCAAATGAACAG No data
Right 1112441980 13:99431240-99431262 GATTGCAGAAAAAGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112441973 Original CRISPR CTGTTCATTTGGGGCAACCT AGG (reversed) Intergenic
No off target data available for this crispr