ID: 1112441987

View in Genome Browser
Species Human (GRCh38)
Location 13:99431289-99431311
Sequence CCCACGGATGTGCCCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112441987_1112441991 -7 Left 1112441987 13:99431289-99431311 CCCAAAGAGGGCACATCCGTGGG No data
Right 1112441991 13:99431305-99431327 CCGTGGGAAAAAAGTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112441987 Original CRISPR CCCACGGATGTGCCCTCTTT GGG (reversed) Intergenic
No off target data available for this crispr