ID: 1112447085

View in Genome Browser
Species Human (GRCh38)
Location 13:99474004-99474026
Sequence GGCCATAGCGTGAAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112447085_1112447089 1 Left 1112447085 13:99474004-99474026 CCAGCACTTTTCACGCTATGGCC No data
Right 1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112447085 Original CRISPR GGCCATAGCGTGAAAAGTGC TGG (reversed) Intergenic
No off target data available for this crispr