ID: 1112447089

View in Genome Browser
Species Human (GRCh38)
Location 13:99474028-99474050
Sequence ATGGCAAAGCAGAAGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112447085_1112447089 1 Left 1112447085 13:99474004-99474026 CCAGCACTTTTCACGCTATGGCC No data
Right 1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG No data
1112447083_1112447089 20 Left 1112447083 13:99473985-99474007 CCTAATGAGGCAGTGGAGGCCAG No data
Right 1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112447089 Original CRISPR ATGGCAAAGCAGAAGATTGA TGG Intergenic
No off target data available for this crispr