ID: 1112447089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:99474028-99474050 |
| Sequence | ATGGCAAAGCAGAAGATTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1112447085_1112447089 | 1 | Left | 1112447085 | 13:99474004-99474026 | CCAGCACTTTTCACGCTATGGCC | No data | ||
| Right | 1112447089 | 13:99474028-99474050 | ATGGCAAAGCAGAAGATTGATGG | No data | ||||
| 1112447083_1112447089 | 20 | Left | 1112447083 | 13:99473985-99474007 | CCTAATGAGGCAGTGGAGGCCAG | No data | ||
| Right | 1112447089 | 13:99474028-99474050 | ATGGCAAAGCAGAAGATTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1112447089 | Original CRISPR | ATGGCAAAGCAGAAGATTGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||