ID: 1112448414

View in Genome Browser
Species Human (GRCh38)
Location 13:99488215-99488237
Sequence CCTTCTGCAGTGAAAGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112448414_1112448420 16 Left 1112448414 13:99488215-99488237 CCTAGTACTTTCACTGCAGAAGG No data
Right 1112448420 13:99488254-99488276 GAAAACAGTCCCTTCCGTTTGGG No data
1112448414_1112448419 15 Left 1112448414 13:99488215-99488237 CCTAGTACTTTCACTGCAGAAGG No data
Right 1112448419 13:99488253-99488275 TGAAAACAGTCCCTTCCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112448414 Original CRISPR CCTTCTGCAGTGAAAGTACT AGG (reversed) Intergenic
No off target data available for this crispr