ID: 1112449948

View in Genome Browser
Species Human (GRCh38)
Location 13:99499226-99499248
Sequence CACATTTACCACTATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112449948_1112449954 5 Left 1112449948 13:99499226-99499248 CCTTCCTGATAGTGGTAAATGTG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1112449954 13:99499254-99499276 CCGAGGTTTAAGCAGACGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1112449948_1112449955 13 Left 1112449948 13:99499226-99499248 CCTTCCTGATAGTGGTAAATGTG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1112449955 13:99499262-99499284 TAAGCAGACGAGTGGTATTAAGG 0: 1
1: 0
2: 0
3: 2
4: 54
1112449948_1112449956 14 Left 1112449948 13:99499226-99499248 CCTTCCTGATAGTGGTAAATGTG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1112449956 13:99499263-99499285 AAGCAGACGAGTGGTATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 90
1112449948_1112449957 23 Left 1112449948 13:99499226-99499248 CCTTCCTGATAGTGGTAAATGTG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1112449957 13:99499272-99499294 AGTGGTATTAAGGGATTTCAAGG 0: 1
1: 0
2: 3
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112449948 Original CRISPR CACATTTACCACTATCAGGA AGG (reversed) Intergenic
900963615 1:5942144-5942166 CACACGGACCACTACCAGGAAGG + Intronic
904926149 1:34049773-34049795 AACAATTACCACTACCTGGATGG + Intronic
906621793 1:47287059-47287081 CAGATTTAAAACTATAAGGAAGG + Intronic
911020722 1:93384955-93384977 CAAATTTGTCACTATCAGTATGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912162601 1:107004140-107004162 CACCTTTGCCACAAGCAGGAAGG + Intergenic
914487861 1:148126788-148126810 CACATTCATCACTTTCATGATGG + Intronic
921816679 1:219571959-219571981 CACATTTACTTATATCAGTATGG + Intergenic
1063165182 10:3455319-3455341 CGCATTTCCCAGTAACAGGATGG - Intergenic
1063175738 10:3549377-3549399 CACAGTTACCACCAGCAAGAAGG + Intergenic
1063345647 10:5310207-5310229 CACATTTAATCCTATCAGGAAGG + Intergenic
1066232202 10:33447065-33447087 CACATTTCCCACTGGCAGAATGG - Intergenic
1066378021 10:34876147-34876169 CACATTTACAACTGTTAGGAAGG - Intergenic
1068633594 10:59323640-59323662 CAAATTTATCACTATCACAAAGG + Intronic
1074918324 10:117980939-117980961 CACATTAATCAGTATCAGCAAGG - Intergenic
1076773187 10:132678440-132678462 CACATTTAACCCTATCACAAAGG - Intronic
1081949276 11:47029200-47029222 CATATTTTCCACTAACAGGTTGG - Intronic
1082731538 11:56803986-56804008 CTCATTTAACATTCTCAGGATGG + Intergenic
1087537260 11:99465146-99465168 CACATTTACTACTTTTAGAAGGG - Intronic
1088135212 11:106548496-106548518 CTCATTTATCACTAAAAGGATGG - Intergenic
1091600721 12:1916180-1916202 TACAATTAAGACTATCAGGAAGG + Intronic
1092609286 12:10154493-10154515 TACAATTAACACTGTCAGGAAGG + Intergenic
1094011720 12:25816803-25816825 CACAATTAGGACTGTCAGGAAGG + Intergenic
1095219054 12:39586695-39586717 CACATTTAACATTTTCAGCAGGG + Intronic
1096587226 12:52630579-52630601 CACATTTCCCACAATAAGGGTGG - Intergenic
1097847759 12:64383692-64383714 CACATTTACCTATATTATGAAGG - Intronic
1098774314 12:74592174-74592196 CACGTTTTCAAATATCAGGAAGG - Intergenic
1099167362 12:79322875-79322897 AACATTTAACACTTTCAGGAGGG - Intronic
1101005508 12:100397598-100397620 CACATTTACCACTGTGTTGATGG - Intronic
1107961153 13:45560412-45560434 CAAATGTACCACTCTCAGGTGGG - Intronic
1109501559 13:63242707-63242729 CACATTTACATCTATCAATATGG - Intergenic
1110434460 13:75463823-75463845 ACCATTTACCAATATGAGGAAGG - Intronic
1110782284 13:79480702-79480724 CACATGTACCACTCTGAGGGGGG + Intergenic
1111236341 13:85413558-85413580 CCACTTTACCACTCTCAGGAAGG + Intergenic
1111955893 13:94758127-94758149 CACGTTTACAAATATCAGCAAGG - Intergenic
1112449948 13:99499226-99499248 CACATTTACCACTATCAGGAAGG - Intergenic
1113944530 13:114036459-114036481 CACAGTGACCATTTTCAGGAAGG - Intronic
1114172726 14:20289690-20289712 CCCATTCACCACTAGCAGGAGGG + Exonic
1115733023 14:36292474-36292496 CACATGTACCACTCTGATGAGGG - Intergenic
1115748076 14:36459079-36459101 CACATTTTCCAATATGAGGGAGG - Intergenic
1116785797 14:49287506-49287528 AACATTTGCCACTATCTTGATGG + Intergenic
1117995302 14:61472400-61472422 CACATGTACCACACACAGGATGG - Intronic
1118784413 14:69034284-69034306 CAAACTTACCTCTGTCAGGAAGG - Intergenic
1120042174 14:79766605-79766627 CACATTCAAAACTACCAGGAAGG - Intronic
1121550303 14:94794456-94794478 CACAGTTACCTCCACCAGGATGG - Intergenic
1129195682 15:73964872-73964894 GACATTTACCACCAGGAGGAGGG - Intergenic
1130011635 15:80157050-80157072 CAGATTTGCCATTTTCAGGAGGG + Intronic
1130691477 15:86085254-86085276 TACATTTACCAGGATGAGGAGGG + Intergenic
1132269407 15:100510721-100510743 CACATCTCCAGCTATCAGGAAGG - Intronic
1133565616 16:6990689-6990711 CACATTCACAACTATTAGGTCGG - Intronic
1135092139 16:19525448-19525470 TACAATTACCACTGTCAGCAAGG - Intronic
1137679340 16:50325809-50325831 CACATTTGCAAATATCAGCAAGG - Exonic
1141137766 16:81477825-81477847 CCCATTTCCCACTAACTGGAAGG - Intronic
1142067313 16:88070163-88070185 CTCATTGACCACTATCAGTAGGG + Intronic
1142624474 17:1183162-1183184 CACATTTAGCTGAATCAGGAAGG - Intronic
1144076379 17:11723231-11723253 CAGATTCCCCACCATCAGGAAGG + Intronic
1144662919 17:17082940-17082962 CAGACCTACCACAATCAGGAGGG - Intronic
1149172563 17:53828356-53828378 ACAATTTACCAGTATCAGGAAGG - Intergenic
1154392469 18:13951547-13951569 CAAATTAACCAATATCAGGAAGG - Intergenic
1158014142 18:52764475-52764497 CTCATTTATCACTGTGAGGATGG - Intronic
1159000529 18:62970915-62970937 AGCATTTACCACCAGCAGGATGG - Intronic
1162512758 19:11129632-11129654 CACATTTGCCACAACCAGGACGG + Exonic
1164129498 19:22348935-22348957 CACATTTCCCACTGTTGGGAGGG - Intergenic
1164170050 19:22717063-22717085 CACATTTCCCACTGTTGGGAGGG + Intergenic
1166457340 19:42952874-42952896 CACATTTAATAATATGAGGATGG + Intronic
925552589 2:5092671-5092693 AACATTTACAAATATCAGCAAGG + Intergenic
926556464 2:14363669-14363691 CACAGATACCACTTTCAGAATGG - Intergenic
926852793 2:17219270-17219292 CACATTTACCAATACCTAGAGGG + Intergenic
930929965 2:56869257-56869279 CTCATTTATCACTAAGAGGACGG + Intergenic
931325558 2:61218463-61218485 CACAGTTAACACTATTATGATGG + Intronic
935047503 2:99495263-99495285 CTCATTCATCACTTTCAGGATGG + Intergenic
936942943 2:117904264-117904286 CACATTTAACATTTTCTGGAAGG - Intergenic
939139382 2:138335460-138335482 AACATTTAACACTTTCAAGATGG - Intergenic
941445602 2:165595029-165595051 CACATGTACCTGTAACAGGAAGG - Exonic
942089230 2:172472481-172472503 CACATTTGCCACTTTTAGAATGG + Intronic
942222851 2:173788297-173788319 GACATTTACCAATATCAGAAGGG + Intergenic
943243075 2:185412425-185412447 CACATTTACTTCTATGAGAATGG - Intergenic
948152161 2:235752951-235752973 CACATATCCCACTAGGAGGATGG - Intronic
1170906617 20:20520984-20521006 CACATTTGCCAGTGGCAGGAAGG + Exonic
1171189271 20:23147200-23147222 CAGATTCATCACTAGCAGGATGG - Intergenic
1171258105 20:23706967-23706989 CACATTCACCACCCTCCGGATGG + Intergenic
1171566534 20:26196789-26196811 CACAGTTAACACAATCAAGATGG - Intergenic
1178621779 21:34183492-34183514 CAAATTTTCCACTAGGAGGAAGG + Intergenic
1182703498 22:32260085-32260107 AACATTGACCACTCTCAGAAGGG + Intergenic
953782942 3:45887550-45887572 CACAGTGACCACTCTCTGGATGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955039118 3:55297879-55297901 CATATTAAGCACTCTCAGGAAGG - Intergenic
955602733 3:60664835-60664857 CAAAATTACCAATACCAGGAAGG - Intronic
956296118 3:67715498-67715520 CACAATTACCCCTATAAGCAAGG - Intergenic
956595956 3:70967431-70967453 CACATTTACAAGTAGAAGGAAGG - Intronic
956999006 3:74862740-74862762 AACATTTTCCACTCTCTGGATGG + Intergenic
957799864 3:85063664-85063686 CACAATTCCCATTATCTGGAGGG - Intronic
960291529 3:115891284-115891306 CACATTTACCAGCATCTTGATGG - Intronic
964757527 3:160102082-160102104 CACATTTGCGAATATCAGCAAGG + Intergenic
969197171 4:5572339-5572361 CACAAATGCCACTATTAGGAAGG + Intronic
969700174 4:8763576-8763598 AATATTTACCCCCATCAGGATGG + Intergenic
974773215 4:66443357-66443379 CACATTTAGCACAAACAGGAAGG - Intergenic
976972974 4:91130749-91130771 CAACTGTTCCACTATCAGGAAGG + Intronic
977870758 4:102088252-102088274 CAAATTTACCAAAATCATGATGG - Intergenic
978405194 4:108371680-108371702 CACACTTACCAATCTCAGCATGG - Intergenic
979728206 4:123990532-123990554 CACCTTTACCACTATCCACAAGG - Intergenic
980680377 4:136152402-136152424 CACATTTACCATGATGAGGGTGG + Intergenic
982498910 4:156129798-156129820 TACAGTGACCACTAACAGGATGG + Intergenic
982890894 4:160848776-160848798 CACATTGATAACTATCAAGAGGG - Intergenic
988598004 5:32612840-32612862 CACATCTCCCAGAATCAGGAGGG - Intergenic
989360952 5:40600503-40600525 CCCATTTAGCACTATCAGAAAGG - Intergenic
989668251 5:43882334-43882356 CACATTTTCCTCTATCATGCTGG - Intergenic
989702591 5:44288032-44288054 CACATGTAACATAATCAGGATGG - Intergenic
990735798 5:58860416-58860438 CACATTTTCCTCTATCACAATGG - Intergenic
994342122 5:98642662-98642684 CACATTGACCACTCTCCTGAAGG - Intergenic
995896480 5:117017788-117017810 CACATTTTCCATTAGCAGTAAGG - Intergenic
995930963 5:117442877-117442899 TAGATTGACCAATATCAGGAAGG - Intergenic
1002410915 5:179075624-179075646 CACATGCACAACTATCTGGAAGG - Intronic
1006058288 6:31401689-31401711 CACAATGAGTACTATCAGGAAGG + Intronic
1007871342 6:45042448-45042470 TGCATTTACCACTATAAGGAGGG - Intronic
1008149316 6:47931203-47931225 CCCATTCACCACGAACAGGAGGG + Intronic
1008770176 6:54968777-54968799 CAATTTTAACAGTATCAGGAAGG - Intergenic
1010115240 6:72298558-72298580 CACATTTACAACTGCAAGGAAGG + Intronic
1013594813 6:111650855-111650877 CACCTCTGCCACAATCAGGAAGG + Intergenic
1014191582 6:118502245-118502267 CACATTTATGAATATCAGCAAGG + Intronic
1015502835 6:133952085-133952107 CACGTTTCCCACTCTCAGGCCGG - Intergenic
1017979277 6:159385391-159385413 CACAATGGCCACTTTCAGGAGGG - Intergenic
1020778917 7:12493868-12493890 TTCAATTGCCACTATCAGGAAGG + Intergenic
1024576589 7:50769484-50769506 CCCATTTTCCTCTGTCAGGAAGG - Intronic
1028923675 7:96334416-96334438 GACATTTACCACTATGATTAAGG - Intergenic
1029411473 7:100414728-100414750 AAAATTTACCATTATCAGGCTGG + Intronic
1029457799 7:100679758-100679780 AACATTGACCACTCTCAGAAGGG + Exonic
1031273323 7:119683883-119683905 CACATTGAGCACTTTCAGTATGG - Intergenic
1033309595 7:140251264-140251286 CACATTTATAACTATGGGGAGGG - Intergenic
1033564324 7:142563860-142563882 AACATTTACCATCATCAGGCTGG + Intergenic
1037455210 8:19056617-19056639 CACATTTTCCATTATCAGTTTGG + Intronic
1044553358 8:93536120-93536142 CACATTTACCCTTATTATGAAGG + Intergenic
1046672300 8:117069657-117069679 CAAATCTACCTCTATCATGAAGG + Intronic
1046745068 8:117867791-117867813 CACATTGACCATTACCAGGCTGG - Intronic
1050657311 9:7843108-7843130 CACATTTCCCACTAGCAAGGAGG - Intronic
1050752590 9:8958123-8958145 CACATTTAGCACCTGCAGGATGG - Intronic
1052277890 9:26699002-26699024 TTCATTTACCACAATCAGGTAGG + Intergenic
1059511538 9:114852615-114852637 TATATTTACAACTATCAGGCTGG + Intergenic
1061281641 9:129601112-129601134 GGCACTTACCACAATCAGGACGG - Intergenic
1061967409 9:134023806-134023828 CACTTTTACCTCTATCTGGCTGG - Intergenic
1186565489 X:10657535-10657557 CACATACTCTACTATCAGGAAGG - Intronic
1188447148 X:30266833-30266855 AACATTCACCACCATCAGTAGGG + Intergenic
1194319186 X:92422462-92422484 CACATTTGCAGCAATCAGGATGG - Intronic
1197422374 X:126254362-126254384 CTAATTTACCACTATCAAGTAGG - Intergenic