ID: 1112452720

View in Genome Browser
Species Human (GRCh38)
Location 13:99526618-99526640
Sequence CTGCTGTCATTGATAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112452720 Original CRISPR CTGCTGTCATTGATAAAGGC AGG Intronic
901158123 1:7154326-7154348 CTGGAGTCATTGATAAATGAGGG + Intronic
903694069 1:25194730-25194752 CTGCAGTCAGTGAGAAACGCAGG + Intergenic
905511780 1:38527476-38527498 CTGATGTCATGGAAAGAGGCGGG + Intergenic
909570597 1:77105469-77105491 CAGCTATTATTGATAGAGGCAGG - Intronic
911399227 1:97353851-97353873 TTTCTGTGATTGATAAAGCCAGG + Intronic
911488474 1:98532077-98532099 GTGCTGTCACAGATAAAGGATGG - Intergenic
911883043 1:103265863-103265885 CTGCAGTCATTGAGGAAGTCAGG - Intergenic
913545114 1:119860370-119860392 CTGCTGTCAGTGAGAACAGCAGG - Intergenic
918867913 1:189926917-189926939 CTGCTGTCATTTATGGAGGATGG - Intergenic
919963922 1:202501988-202502010 CTGCTGTCCTTGACATAGGTGGG + Intronic
920423977 1:205858564-205858586 GTGTGGGCATTGATAAAGGCAGG + Intergenic
921162389 1:212482503-212482525 CTCCTGTCATTGGTCAGGGCTGG - Intergenic
924927414 1:248696415-248696437 CTGCTGTCATGGGCAAAGACTGG - Intergenic
1065406996 10:25379460-25379482 AGGCTGTCATTGAGAAAGCCAGG + Intronic
1069140119 10:64811821-64811843 CTGTTGTCATTGCTCAAGGAAGG + Intergenic
1074824573 10:117205478-117205500 CTGCTGTCTTTGGCAAAGGTGGG - Intronic
1076130444 10:128010318-128010340 CTGCTGTCTTTAGCAAAGGCTGG - Intronic
1076224201 10:128760533-128760555 CAGCAGTCATTTGTAAAGGCAGG - Intergenic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1083123947 11:60544631-60544653 CTGCTGACATTGATCTTGGCAGG + Intergenic
1084873502 11:72113575-72113597 CTGCTGTCCCTGAAAGAGGCTGG - Intergenic
1093437249 12:19149772-19149794 TTGCTGTGATTGATGAAGACAGG + Intronic
1095610142 12:44118454-44118476 CTGCTGAAAATGATAAAGGAAGG + Intronic
1096041873 12:48524340-48524362 ATGCTGTCATTCAGAAAGGAGGG - Intronic
1096815809 12:54201106-54201128 CTCCTGTCACTGCTAAGGGCTGG - Intergenic
1101019352 12:100537234-100537256 CTTGTGACATTGAGAAAGGCAGG + Intronic
1101135218 12:101737270-101737292 CTGCAGTCATTGAGAAACGTAGG - Exonic
1102845943 12:116182411-116182433 TTTCTGTCATTGAAAAAGGAAGG - Intronic
1103249297 12:119486139-119486161 CTGCTGCTATTGCTAAATGCTGG + Intronic
1107401071 13:40069761-40069783 CTGCTGTCCTTGATAATAGCAGG - Intergenic
1109843395 13:67950934-67950956 CTACTGTCATTATTAAAAGCAGG - Intergenic
1111895666 13:94138766-94138788 CTATTGTCATTGTTACAGGCTGG - Intronic
1112452720 13:99526618-99526640 CTGCTGTCATTGATAAAGGCAGG + Intronic
1118522146 14:66596908-66596930 CTGGTGTCATTGATGATGCCAGG + Intronic
1119049800 14:71356051-71356073 CTGCTGCTACTGATAAAGTCAGG + Intronic
1120195393 14:81476937-81476959 TCGCTGTCACTGATCAAGGCTGG + Exonic
1125158787 15:36619441-36619463 CTGATGTGATTTATAAATGCTGG + Intronic
1125751415 15:42031787-42031809 CTGCAGTAATTGAGCAAGGCTGG + Intronic
1129557574 15:76528866-76528888 CTTCAGTCATTCATAATGGCTGG - Intronic
1131684509 15:94755176-94755198 CTGATTTGATTAATAAAGGCTGG - Intergenic
1132137970 15:99362560-99362582 AAGCTGTCATTAATAAAAGCAGG - Intronic
1132633907 16:933602-933624 CTGAGGTCATGGAGAAAGGCAGG + Intronic
1133726648 16:8543621-8543643 TGGCTGTCATTGAGAAAGGAAGG - Intergenic
1135198747 16:20418439-20418461 ATGATGTAATTGATAAAAGCAGG + Intronic
1135754221 16:25083127-25083149 CTGCTGGCTTTGACAAATGCAGG + Intergenic
1141354087 16:83327085-83327107 CTTGTGTCATTTATAAAGGCAGG + Intronic
1145806493 17:27737043-27737065 CTAAGATCATTGATAAAGGCAGG + Intergenic
1147562035 17:41515243-41515265 CTTCTGTAAATGATAGAGGCTGG - Intronic
1149220936 17:54414686-54414708 GTGATGTCAGTAATAAAGGCTGG - Intergenic
1151366989 17:73623926-73623948 GTGCTGTCTTTGATACAGGAAGG - Intronic
1151562112 17:74876068-74876090 CTGCGGTCTTTGGTAAAGGAAGG + Intergenic
1152552895 17:81038653-81038675 CTGGTGTGATTGGTAAGGGCTGG + Intronic
1153691158 18:7595151-7595173 CTGCTGCTGTTGATGAAGGCAGG + Intronic
1157404658 18:47412798-47412820 CTACTCTCATTGATCCAGGCTGG - Intergenic
1159673782 18:71255929-71255951 GAGCTTTTATTGATAAAGGCAGG + Intergenic
1162600437 19:11664568-11664590 CTCCTGCCAGTGATCAAGGCAGG - Intergenic
1163076774 19:14899599-14899621 CTGTGGTCAGTGTTAAAGGCAGG + Intergenic
1166818208 19:45559850-45559872 TTGCTGCCATTTATTAAGGCCGG - Intronic
925186571 2:1850739-1850761 TTGCTGTCATTGCTGATGGCCGG - Intronic
928455221 2:31414657-31414679 CTGCTGTCATTGTCACAGGTTGG + Exonic
931042940 2:58318105-58318127 CTGATTTGATTAATAAAGGCTGG - Intergenic
931243388 2:60472143-60472165 CGTCTGTCATTGATAAGGACAGG + Intronic
932388380 2:71360028-71360050 CTTCTCTCATTGATAAAGTCTGG - Intronic
932810010 2:74817176-74817198 CTCCTGTGATTTAAAAAGGCAGG + Intergenic
935186875 2:100742716-100742738 CAGCTGTTCTTGATCAAGGCTGG - Intergenic
936608250 2:113978450-113978472 TTACTGTCACTGCTAAAGGCAGG - Intergenic
942858581 2:180582467-180582489 CTGCTGTCAGTAATAATGGAGGG - Intergenic
942954213 2:181755259-181755281 CTGCTGTCATTTATAACCCCTGG + Intergenic
944320487 2:198335423-198335445 CTGCTCACATTGATCAGGGCAGG - Intronic
946302591 2:218832865-218832887 CAGATGTCCTTGAGAAAGGCTGG - Intergenic
946611091 2:221458801-221458823 CTGCTGACACTGACAATGGCTGG + Intronic
947670433 2:231932324-231932346 GAGTTGTCATTGATAAAGGCTGG + Intergenic
1172912490 20:38420329-38420351 CTGATGTCATTCAGGAAGGCTGG - Intergenic
1174741823 20:53021650-53021672 CTGCTGGAGTTGGTAAAGGCTGG - Intronic
1178797757 21:35760883-35760905 TTGTTGTCATTGATACAGGTGGG - Intronic
1180654473 22:17407883-17407905 CTGCTGAGATTGAGAAACGCTGG + Intronic
1184401351 22:44276460-44276482 CTGCTGTCGGGGACAAAGGCTGG + Intronic
950128093 3:10523115-10523137 CTGCTGACAGTGACAATGGCTGG + Intronic
950156763 3:10726861-10726883 CTGCTGTCATTACTAAGGCCTGG - Intergenic
950354012 3:12388111-12388133 CTGTTCTCATTGATAAATGTTGG - Intronic
951126277 3:18988013-18988035 CTGCTGCCACTGTTAAAGGATGG + Intergenic
957880199 3:86201955-86201977 CTGCTGTCATTGACAAATAGAGG + Intergenic
962235486 3:133703463-133703485 CTGCTTTCATTTATAAAAGAGGG + Intergenic
962450164 3:135506868-135506890 CTGCTGTGAGTGAGTAAGGCCGG - Intergenic
963049210 3:141127386-141127408 CTGCTGTTATTATCAAAGGCAGG - Intronic
963819368 3:149870930-149870952 CTGATTTCATTTATAAAGGAAGG - Intronic
964218321 3:154314377-154314399 CTGCTGTCTTTGATAAAGGAAGG - Intronic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
965070726 3:163912692-163912714 CTGATTTGATTAATAAAGGCTGG - Intergenic
966761935 3:183427015-183427037 CAGCTTTTATTGATAAAGCCAGG - Intronic
968275717 3:197438700-197438722 CTGCTGTCAATGATGAAGCTGGG + Intergenic
973761803 4:54124207-54124229 CTGCAATCATTGATAAAGTATGG + Intronic
979894850 4:126146437-126146459 CTGATTTGACTGATAAAGGCTGG + Intergenic
982763556 4:159317057-159317079 CTGTTGGAATTGATAAAGGATGG + Intronic
986870949 5:12045577-12045599 CTGTTGTCATTGAGAAATGAAGG + Intergenic
989367810 5:40676152-40676174 CTGCTGCTATTGATTAAGCCAGG + Intergenic
992622857 5:78610689-78610711 CTGCTTTCATTGTTAGAGGCTGG - Intronic
993205191 5:84869543-84869565 GTGCTGTCATTAATGAATGCTGG + Intergenic
995964518 5:117888281-117888303 ATGCAGACATTGTTAAAGGCAGG + Intergenic
996326243 5:122277738-122277760 CTGCTATCATTGATGGAAGCTGG - Intergenic
996494166 5:124134130-124134152 CTGCTGTGCATGATACAGGCCGG + Intergenic
999072659 5:148763156-148763178 GTCCTGTCATTAATAAAGGCAGG + Intergenic
999291637 5:150429744-150429766 ATGATGTCATTCATAAAAGCAGG + Intergenic
1002853888 6:1020835-1020857 CTGCTGGCCTTGGTGAAGGCAGG - Intergenic
1007662965 6:43497676-43497698 GTACTGTCATGGAGAAAGGCAGG + Intronic
1008176336 6:48271694-48271716 CTACTGTTATTATTAAAGGCAGG - Intergenic
1013373606 6:109492129-109492151 CTGCTGCCCTTCGTAAAGGCAGG + Intergenic
1023092851 7:36632743-36632765 CTCCCTTCATTGATAAATGCTGG - Intronic
1024783395 7:52877827-52877849 GTGCTTTCATTTAAAAAGGCAGG - Intergenic
1025234843 7:57227582-57227604 CTGCTTTCACTTACAAAGGCAGG - Intergenic
1028018162 7:85740533-85740555 CTACTCTCCTTGATAAAGGTGGG + Intergenic
1028365970 7:90032657-90032679 CTGCTTTCATTGACAATAGCAGG + Intergenic
1028690488 7:93644262-93644284 CTGATTTCACTAATAAAGGCTGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031444751 7:121838140-121838162 CTGTTGTCATTTATAAAGTCAGG + Intergenic
1034190462 7:149209456-149209478 CTGCAGTCCTTGATGAAGACAGG - Intronic
1035705617 8:1672178-1672200 CTGATCTCATTTATAAAGGTGGG - Intronic
1036931064 8:12955874-12955896 CTGCTGTCATTGCCACAGCCTGG + Intronic
1039194246 8:35013371-35013393 CTGCTGCCACTGATTAAGGTTGG - Intergenic
1039886227 8:41655538-41655560 CAGCTGTCATTGCAAGAGGCAGG + Exonic
1042866934 8:73364959-73364981 CTGCTGTCATTGACAGTGTCAGG + Intergenic
1047591476 8:126331633-126331655 ATTCTGTCATTGATAAAGTCAGG + Intergenic
1056053652 9:82797632-82797654 CTGCTGTCACTGATCATGGATGG - Intergenic
1056819629 9:89829586-89829608 CTGCTGTCACTGCTAAAGTCTGG - Intergenic
1058771321 9:108235255-108235277 CTGCCATAATTGATAAATGCTGG + Intergenic
1059068692 9:111111446-111111468 CTGCTGGCATAAATCAAGGCAGG + Intergenic
1060318104 9:122531755-122531777 CTGATTTGACTGATAAAGGCTGG + Intergenic
1061433593 9:130546724-130546746 TTGCTGTAATTGAGCAAGGCGGG + Intergenic
1187088228 X:16064858-16064880 CTGCTGTAATGGAGAAAGGCAGG - Intergenic
1189290135 X:39878984-39879006 ATGCTGGCTTTGAGAAAGGCAGG - Intergenic
1190284647 X:48954072-48954094 CTCCTGTCATTGGGAAGGGCAGG + Intronic
1197172040 X:123445015-123445037 CTGCTGATGTAGATAAAGGCTGG - Intronic
1197296491 X:124725040-124725062 TTGCTGTCATTTCTAGAGGCTGG - Intronic
1197933416 X:131716475-131716497 CTGATTTGATTAATAAAGGCCGG - Intergenic
1198002512 X:132453522-132453544 CTGGGGTCATTGATAAATGATGG - Intronic
1199576795 X:149320062-149320084 CTGATTTGACTGATAAAGGCTGG - Intergenic
1201061308 Y:10049226-10049248 GTGATGTGACTGATAAAGGCTGG + Intergenic