ID: 1112452814

View in Genome Browser
Species Human (GRCh38)
Location 13:99527191-99527213
Sequence ACTAATATTCAGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112452810_1112452814 -5 Left 1112452810 13:99527173-99527195 CCTGGACTTCTGGTGGTGACTAA 0: 1
1: 1
2: 0
3: 16
4: 85
Right 1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG 0: 1
1: 0
2: 0
3: 23
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112452814 Original CRISPR ACTAATATTCAGAGGGTAGA GGG Intronic
900503465 1:3017731-3017753 ACAAGTAGTCAGAGGGTCGAAGG + Intergenic
902972300 1:20062655-20062677 ACCAAAATTCAGAGGGGACAGGG + Intronic
904935305 1:34125959-34125981 AGTGATATTCAGAAGGGAGAGGG + Intronic
905982811 1:42246271-42246293 ACTAATATTCAGAATATACAAGG + Intronic
907561268 1:55390772-55390794 ACTAATATTCAGAATCTACAAGG - Intergenic
907563744 1:55415133-55415155 ACTAATATCCAGAGTCTACAAGG - Intergenic
907756946 1:57319745-57319767 ACGAATAAACAGAGGGTAGGTGG + Intronic
907854577 1:58289750-58289772 AATAAGATCCAGAGGGGAGAGGG - Intronic
907958031 1:59250168-59250190 ACTAAAATGCAGTGGGAAGAAGG + Intergenic
908585970 1:65569051-65569073 ACTAATATCCAGAATTTAGAAGG - Intronic
908812259 1:67994899-67994921 ACTAATATCCAAAATGTAGAAGG + Intergenic
908890390 1:68840315-68840337 ACTAATATTCAGAATCTATAAGG - Intergenic
909565635 1:77050592-77050614 ATAAATATTCAGAGGATAAATGG - Intronic
909652155 1:77987605-77987627 ACTAAAATAGAGAGGGGAGAAGG - Intronic
909827938 1:80149275-80149297 ACTAATATCCAGAGTCTACAAGG - Intergenic
909940924 1:81610886-81610908 ACTAAGATGCAGAGGATTGAGGG + Intronic
909984311 1:82141859-82141881 ATTCTTATTCAGAGGGTAGTGGG + Intergenic
910341441 1:86192955-86192977 AGTTATACTTAGAGGGTAGAAGG + Intergenic
910556283 1:88537424-88537446 AATAATTTTCTGAGGGAAGAGGG + Intergenic
911655135 1:100435229-100435251 AGTAGTGTTTAGAGGGTAGAAGG + Intronic
911925504 1:103825751-103825773 ACTAATATTCAGAATATATAAGG + Intergenic
912159550 1:106965108-106965130 AAAAATATTCAGAAGGTAGAAGG - Intergenic
912161545 1:106991956-106991978 ACTAATATTCAGAATCTACAAGG + Intergenic
912642491 1:111360774-111360796 AATCATATGCAGAGGGGAGATGG - Intergenic
913373475 1:118126563-118126585 ACTAATATTCAGAATATATAAGG - Intronic
913672494 1:121110877-121110899 ATTAGTATTCAGATGGTATATGG + Intergenic
914024259 1:143898241-143898263 ATTAGTATTCAGATGGTATATGG + Intergenic
914662752 1:149806264-149806286 ATTAGTATTCAGATGGTATATGG + Intronic
916331257 1:163619732-163619754 ACTAATATTCAGAATCTACAAGG - Intergenic
916343622 1:163763568-163763590 ACTAATATTCAGAATTTACAAGG + Intergenic
916382143 1:164223786-164223808 ACTAATATTCAGAATCTACAAGG + Intergenic
916633714 1:166644912-166644934 ACTAATATTCAGACTATACAAGG + Intergenic
916865962 1:168859018-168859040 TCTAATATTCAGAGTCTACAAGG + Intergenic
917188696 1:172390513-172390535 ACTGAAATCTAGAGGGTAGAGGG - Intronic
918667501 1:187170334-187170356 ACTAATATTCAGAATCTACAAGG - Intergenic
919093460 1:193001119-193001141 ACTAATATCCAGAAGCTACAGGG + Intergenic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
921272809 1:213487909-213487931 ACCAATAGCCAGAGGCTAGAGGG - Intergenic
921502718 1:215925635-215925657 TCCCTTATTCAGAGGGTAGAAGG - Intronic
921788241 1:219258882-219258904 ACTAATATTCAGAATCTACAAGG + Intergenic
921830266 1:219720682-219720704 ACTAATATTCAGAATCTACAAGG + Intronic
921998826 1:221453140-221453162 ACTAATATCCAGAGTATACAAGG - Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
923919649 1:238548862-238548884 ACTAATATTCAGAATCTACAAGG + Intergenic
924096642 1:240558593-240558615 TCTATTAATCAGAGGGTAAAAGG + Intronic
924162034 1:241242859-241242881 ACTAATATCCAGAATGTACAAGG - Intronic
924197758 1:241625904-241625926 ACTGTCATTCAGTGGGTAGAGGG - Intronic
924929880 1:248721115-248721137 ACTAATATTCAGAATATAAAAGG + Intronic
1065504336 10:26414368-26414390 ACTAAAGGTTAGAGGGTAGAAGG + Intergenic
1065778178 10:29142232-29142254 ATTAATTTAGAGAGGGTAGAAGG - Intergenic
1065832222 10:29624816-29624838 AATAATAATCAGATGGTAAATGG - Intronic
1066047844 10:31609524-31609546 ACTAATATCCAGAATGTACAAGG - Intergenic
1066529092 10:36316603-36316625 ACTAAAATTCAGATGAGAGATGG - Intergenic
1067173738 10:43927892-43927914 ACCAAACCTCAGAGGGTAGAGGG - Intergenic
1068470224 10:57452064-57452086 ACTAATGTTCATAGTATAGAAGG + Intergenic
1069287018 10:66728309-66728331 TCTAATATCCAGAGTGTACAGGG - Intronic
1070454149 10:76593089-76593111 ACTAATATTCAGAATCTACAAGG + Intergenic
1072516911 10:96193437-96193459 ACAAATATTCAGGGACTAGAGGG - Intronic
1072855783 10:98944625-98944647 ACTAAGCTTTAGAGGGGAGAAGG + Intronic
1074331291 10:112512429-112512451 ACTAATATTCAGAATATATAAGG - Intronic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1078039173 11:7842158-7842180 ACTAATATCCAGAGTCTATAAGG - Intergenic
1079823013 11:25155425-25155447 TCTAATATTTAGAGTGTACAAGG - Intergenic
1081023673 11:37981695-37981717 ACTAACATTCTGAGAGTCGAAGG + Intergenic
1081292001 11:41337798-41337820 TCTAATATTCAGAATTTAGAAGG + Intronic
1081539561 11:44021497-44021519 ACTAATATACAGAAGCTACAAGG - Intergenic
1081840523 11:46197867-46197889 ACTAATATTCAGAGCAGAGATGG + Intergenic
1082878583 11:58014785-58014807 TCTAATATTCAGAGCCTACAAGG + Intergenic
1082937590 11:58670595-58670617 CGTAATATCCAGGGGGTAGAGGG - Intronic
1083335246 11:61918111-61918133 AATACTATCCAGAGGGCAGATGG - Intronic
1084261685 11:67983182-67983204 CCTAATATCCGGAGGGGAGAGGG + Intergenic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1086247981 11:84777832-84777854 ACTAATATTCAGAATTTACAAGG - Intronic
1086532583 11:87803285-87803307 ACACATACTCAGAGGGAAGATGG - Intergenic
1087670976 11:101106339-101106361 ACTAATATCCAGAATCTAGAAGG + Intronic
1087692987 11:101343516-101343538 ACTAATATTCAGAATCTATAAGG - Intergenic
1088068815 11:105755885-105755907 ACTGAAATTCAGAGGATGGATGG - Intronic
1088074939 11:105836481-105836503 AAGAATATACAGAGGGCAGATGG - Intronic
1088385079 11:109245325-109245347 TCTAATATCCAGAGTCTAGAAGG + Intergenic
1092715710 12:11388147-11388169 ACTAATATGCAGAGTATACAAGG + Intronic
1092929407 12:13301021-13301043 ACTAATATTCAGAATCTACAAGG + Intergenic
1093015990 12:14155208-14155230 TCTAATATTCAGAGTCTATATGG + Intergenic
1093219080 12:16397538-16397560 ACTAATATCCAGAGACTACAAGG + Intronic
1093592673 12:20923186-20923208 ATTAATATTCAGAGTATACAAGG - Intergenic
1093677561 12:21961902-21961924 ACTAATATTCAGAATATACAAGG + Intergenic
1093902829 12:24655279-24655301 ACTAATAATCAGAATGTATAAGG - Intergenic
1095613149 12:44155991-44156013 ACTAAAATTCAGGGGGGACAAGG + Intronic
1095786594 12:46116319-46116341 ACTAATATCCAGAATGTACAAGG + Intergenic
1095842717 12:46711730-46711752 ACTAATATTCAGAATTTATAAGG + Intergenic
1096043132 12:48538158-48538180 ATTAATATTCAGAATGTACAAGG + Intergenic
1096051204 12:48609866-48609888 ACTAATATTGAGAGTCTACAGGG - Intergenic
1096555099 12:52398960-52398982 AATAAGATTCAAAGGGGAGATGG - Intronic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1097531532 12:60807507-60807529 ACTAATATTCAGAATCTATAAGG - Intergenic
1097554369 12:61118785-61118807 ACTAATATCCACAGTGTAAAAGG - Intergenic
1097600258 12:61682869-61682891 ACTAATATTCAGACTCTAGAAGG - Intergenic
1097607524 12:61773964-61773986 ACTAATATCCAGAGTCTACAAGG + Intronic
1097650143 12:62287450-62287472 ACTAATATTCAGAATTTACAAGG - Intronic
1099287245 12:80729395-80729417 ACAAAATTTCAGAAGGTAGATGG - Intergenic
1100108987 12:91214020-91214042 ACTAATATTCAGAAACTACAAGG - Intergenic
1100974272 12:100105820-100105842 ACTAATATTCAGAATCTACAAGG + Intronic
1101946167 12:109139202-109139224 ACTAAGATCCAGAGGGGTGAAGG + Intronic
1102187919 12:110964352-110964374 ACTAAGGTTCAGAGGGGTGAAGG + Intergenic
1102459092 12:113089246-113089268 AATGAGGTTCAGAGGGTAGATGG + Intronic
1105430450 13:20332692-20332714 ACTCATATTCAGAGGTTAGGAGG + Intergenic
1106516484 13:30459258-30459280 ACTAATCTTCAGATTGAAGAGGG + Exonic
1106541357 13:30693048-30693070 ACTAATATTCAGAAGCTACAAGG - Intergenic
1107953640 13:45487503-45487525 ACTAATATTCAGAATATACAAGG + Intronic
1108261623 13:48662728-48662750 ACTAATATTCAGAATATACAAGG - Intronic
1109619645 13:64886599-64886621 ACTAATATCCAGAGTATACAAGG - Intergenic
1110521022 13:76476856-76476878 AATGATATTCAGAGGGTTGTTGG + Intergenic
1110590884 13:77257439-77257461 AATAATAATCACAGGGTAAATGG - Intronic
1111120091 13:83836474-83836496 ACTAATATTCAGAATTTACAAGG + Intergenic
1111193016 13:84833789-84833811 ACTAATATCCAGAATGTACAAGG - Intergenic
1111754796 13:92379653-92379675 ACTAATATGCAGGGGGCACAGGG - Intronic
1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG + Intronic
1114767640 14:25392270-25392292 ACTAATATTCAGAATCTAGAAGG - Intergenic
1114767996 14:25396251-25396273 AGTAATATTCATAGCTTAGAGGG - Intergenic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1115784885 14:36814432-36814454 ACTAATATTCAGAATCTACAAGG + Intronic
1116277433 14:42853575-42853597 ACTAATATGCAGTGGGTTTAGGG + Intergenic
1116517821 14:45821074-45821096 CCTAATATCCAGAGGGTAAGAGG + Intergenic
1117654977 14:57946003-57946025 ACTAATATCCAGAGTCTACAAGG - Intronic
1117857069 14:60046150-60046172 TCTAATATTCAGAGTCTACAAGG - Intronic
1117945839 14:61019506-61019528 AGAAATATTCAGAAGATAGAAGG - Intronic
1118503145 14:66382171-66382193 AATAATATGCAAAGGGAAGAGGG + Intergenic
1118846761 14:69553304-69553326 ACTAAAACTAAGAGGGAAGAAGG - Intergenic
1120213770 14:81660283-81660305 ACTGAATTCCAGAGGGTAGAAGG + Intergenic
1120745877 14:88151243-88151265 ACTAATATTCAGAATTTACAAGG - Intergenic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1122331740 14:100922235-100922257 ACTAATATTCAGAATCTACAAGG - Intergenic
1122656346 14:103262591-103262613 ACTAATATCCAGAAGATACAAGG - Intergenic
1123100509 14:105795205-105795227 ACTAATATTCAGAATATACAAGG + Intergenic
1202893847 14_KI270722v1_random:184230-184252 ACCAACATTCAGAAGGAAGAGGG + Intergenic
1123883825 15:24702776-24702798 TCTAATATTCAGAATGTATAAGG - Intergenic
1124471873 15:29994758-29994780 ACTAATATCCAGAATTTAGAAGG + Intergenic
1124478011 15:30052496-30052518 ACTAATATTCAGAATGTACAAGG - Intergenic
1125247854 15:37661961-37661983 ACTAATATTCAGAATCTATAAGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125581016 15:40785793-40785815 ACTCTTATTCAAGGGGTAGAAGG + Intronic
1126521066 15:49594303-49594325 ACTAATATCCAGAGTCTACAAGG - Intronic
1127347833 15:58118778-58118800 ACTAATATTCAGCGAGCAGTAGG + Intronic
1129089382 15:73132647-73132669 ACTAATATCCAGAAGCTAGAAGG + Intronic
1129376123 15:75133239-75133261 AGTAATTTTTAGAGTGTAGAGGG - Intergenic
1130528794 15:84729781-84729803 ACTAATATCCAGAGACTATAAGG - Intergenic
1131939301 15:97543095-97543117 TCTAATATTCAGAGTCTACAAGG - Intergenic
1132317760 15:100902331-100902353 AATAATATGCTGAGGTTAGACGG - Intronic
1132520360 16:384524-384546 AATAATTTTCAGAAGGTTGAGGG - Intronic
1133549591 16:6841128-6841150 GCTAATATCCAGAGTGTACAAGG - Intronic
1133549994 16:6845059-6845081 TCTAATATCCAGAGTGTACAAGG - Intronic
1133616003 16:7477496-7477518 AATAATATTCAGGGGGCAGAAGG - Intronic
1133902416 16:9989651-9989673 GCTAATATTCAGAAGCTATAAGG + Intronic
1135215832 16:20568942-20568964 ACTAATATTCAGAATCTAGAAGG - Intronic
1135286260 16:21195872-21195894 ACTAATATTCACAGGCTCTAGGG + Intergenic
1137412358 16:48239782-48239804 TCTAATATCCAGAGTCTAGAAGG + Intronic
1137482061 16:48860359-48860381 ACTAATATTCAGAATTTATAAGG + Intergenic
1138226012 16:55295318-55295340 TATGATATTCAGAGGTTAGAGGG - Intergenic
1138637631 16:58354179-58354201 ACTAATATCCAGAATATAGAAGG - Intronic
1138933639 16:61692751-61692773 ACTAATCTTCGGTGAGTAGATGG + Intronic
1140552094 16:75877422-75877444 ACTAATATTCAGAATCTACAAGG - Intergenic
1140733638 16:77878543-77878565 AGCAGTATTCAGAGGGCAGATGG - Intronic
1144359293 17:14476602-14476624 GCTAATATCCAGAGTCTAGAAGG + Intergenic
1145103738 17:20097900-20097922 ACTAATATTTAACGGGTAGGAGG - Intronic
1146117869 17:30158345-30158367 ACTAATATCCAGAATATAGAAGG - Intronic
1146427213 17:32752530-32752552 ACTAATATTCAGAATCTACAAGG + Intronic
1148136315 17:45294160-45294182 ACTCTTATGCAGAGAGTAGAGGG - Intronic
1150051363 17:61967431-61967453 ACTAACATTCAGATTGTATAAGG + Intronic
1152384833 17:79966184-79966206 ACCCATATACAGAGGGAAGAAGG - Intronic
1153829222 18:8906224-8906246 ACTAATATTCAGAATCTACAGGG + Intergenic
1155340161 18:24805641-24805663 ACAAATCTTCAGAGGGTTAAGGG + Intergenic
1155763142 18:29591006-29591028 TCTAATATTCAGAATGTACAAGG + Intergenic
1157463904 18:47928098-47928120 AGTCATTTTTAGAGGGTAGAGGG - Intronic
1157738970 18:50075214-50075236 GCTAATATTCAGGGGAGAGAGGG + Intronic
1158738884 18:60116310-60116332 ACTAATATCCAGACTCTAGAAGG + Intergenic
1160480012 18:79231258-79231280 ACTAATATTCAGAATCTACAAGG + Intronic
1161760656 19:6168751-6168773 ACTAATATTCAGAATCTATAAGG - Intronic
1162752518 19:12837718-12837740 ACTAGTATTTATAGGGTAAAGGG - Intronic
1163199400 19:15753614-15753636 ACTAATATCCAGAGTCTACAAGG - Intergenic
1165281879 19:34804686-34804708 AGTAATTTTCAGTGGGTATATGG - Intergenic
1166243517 19:41509961-41509983 CCTAATATCCAGGGGGGAGAGGG - Intergenic
1167003829 19:46762536-46762558 ACTAATAGTCAGGGGGTTCATGG - Intronic
925505882 2:4563409-4563431 ACTAATATCCAGAATTTAGAAGG + Intergenic
926930184 2:18029890-18029912 ACTAATATTCAGACTATACAAGG - Intronic
927120077 2:19951220-19951242 ACTAAAATAAAGATGGTAGATGG - Intronic
927355732 2:22170946-22170968 ACTAATATTCAGAATCTATAAGG + Intergenic
927390923 2:22594487-22594509 TCTAATATCCAGAGTCTAGAAGG + Intergenic
927440182 2:23109869-23109891 TCTAATATTCAGAGTCTACAAGG - Intergenic
928297823 2:30100318-30100340 ACTAATATCCAGAACCTAGAAGG - Intergenic
928546754 2:32335811-32335833 ATTAATGTTCAGAGGGAACATGG - Intergenic
931045537 2:58348063-58348085 ACTAATATTCAGAATATACAAGG + Intergenic
931519937 2:63084606-63084628 ACTAATATCCAGAGTCTATAAGG - Intergenic
933053914 2:77637173-77637195 ACTAATATCCAGAATGTACAAGG - Intergenic
933402462 2:81816362-81816384 ACTAGCATTTAGTGGGTAGAAGG - Intergenic
933562620 2:83907371-83907393 ACAAATATTCAGAATGTACAGGG - Intergenic
933675791 2:85056308-85056330 TCTAATATTGAGAGGGAAAATGG - Exonic
934698105 2:96415015-96415037 TCAAATCTTCAGAGAGTAGAAGG + Intergenic
936018090 2:108974776-108974798 ACTGAAACTGAGAGGGTAGAGGG + Intronic
936633533 2:114230517-114230539 ACTAATATCCAGAATGTACAAGG - Intergenic
936673761 2:114689962-114689984 ACTAATATCCAGAGTCTACAAGG - Intronic
938473559 2:131588102-131588124 ACTAATGTGCAGAGTATAGAAGG + Intergenic
938665871 2:133536016-133536038 ACTAATATCCAGAGTCTACAAGG - Intronic
938924190 2:136024264-136024286 AATATTACACAGAGGGTAGAGGG + Intergenic
939058302 2:137389450-137389472 ACTAATATCCAGAATATAGAAGG - Intronic
939449661 2:142357069-142357091 ACTAATATCCAGAGTCTACAAGG + Intergenic
939973100 2:148684234-148684256 ACTAATATTCAGAATCTACAAGG - Intronic
940597195 2:155810318-155810340 TGTAATATTCATAGGGAAGAAGG - Intergenic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
942050517 2:172136026-172136048 ACTAATTTTAAGAGTGTAAAGGG - Intergenic
942623740 2:177876844-177876866 GCAAACCTTCAGAGGGTAGAAGG - Intronic
943029052 2:182665330-182665352 CCTAATATTCAGAAGCTACAAGG + Intergenic
943034089 2:182719143-182719165 AATAATACTCGGATGGTAGAAGG - Intronic
945536116 2:211019992-211020014 ACTAATATCCAGAGTCTACAAGG - Intergenic
946947797 2:224839782-224839804 ACTAATAATAAGAGATTAGAAGG + Intronic
948812350 2:240487856-240487878 ACTAATATTCAGAATATACAGGG - Intronic
1168884883 20:1242167-1242189 CATAATTTTCAGAGGGGAGAAGG + Intronic
1169412874 20:5388392-5388414 ACTAATATCCAGAGTATACAAGG + Intergenic
1169607856 20:7342839-7342861 GCTAATATCCAGAGTGTACAAGG + Intergenic
1169779174 20:9290942-9290964 ACTAAGACTCAGAGGGTTAAGGG + Intronic
1169836174 20:9881755-9881777 ACTAATATCCAGAGCATAAAAGG - Intergenic
1171517292 20:25747612-25747634 GCAGATATTCAGAGGGTAGGAGG + Intergenic
1172305250 20:33876057-33876079 ACTAATACACAGAGGAAAGAAGG + Intergenic
1173588660 20:44206348-44206370 ACTAACATTCAGAGAGCAGCTGG + Intronic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1175232982 20:57486657-57486679 ACTAATATTCAGAATCTACAAGG + Intergenic
1176588659 21:8617904-8617926 ACTAATATTCAGAATCTACAAGG + Intergenic
1177481190 21:21691347-21691369 ACTAATACTCAGAAAGTCGATGG + Intergenic
1177574393 21:22932288-22932310 ACTAATATCCAGAGTCTATATGG - Intergenic
1177614786 21:23502710-23502732 ACTAATATTCAGAATCTACAAGG - Intergenic
1177699058 21:24613405-24613427 ACTAATATTCAGAATTTACAAGG + Intergenic
1178117367 21:29431185-29431207 ACAAATAGTTATAGGGTAGAAGG + Intronic
1180271488 22:10594898-10594920 ACTAATATTCAGAATCTACAAGG + Intergenic
1181411877 22:22729551-22729573 ACAAGTTTTCAGAGTGTAGAGGG - Intergenic
1183175212 22:36218931-36218953 TCTAATATTCAGAGTCTACAAGG - Intergenic
949138660 3:603861-603883 ACTAATATTCAGAATCTACAAGG - Intergenic
949166534 3:949457-949479 ACAAGAATTCAGAGGTTAGAAGG + Intergenic
949504722 3:4716471-4716493 ACTACTATTCAGAAGGGAAATGG - Intronic
950295703 3:11828359-11828381 AGTAATATTCAGAATTTAGAAGG + Intronic
951161190 3:19424710-19424732 ACTAATATTCAGAATCTACAAGG + Intronic
951241427 3:20289911-20289933 ACTAATATTCAGAATATACAAGG - Intergenic
952962320 3:38600167-38600189 TCTAATCTTCATAGGGCAGAGGG + Intronic
953363010 3:42316294-42316316 ACTAATATTCAGAATCTACAAGG - Intergenic
953927679 3:46990641-46990663 ACTGAAACTCAGAGGGCAGAAGG - Intronic
954347151 3:50009720-50009742 GCTAATTTTGAGGGGGTAGAGGG + Intronic
954517524 3:51191866-51191888 ACTAATATTCAGAGTAGACAAGG - Intronic
954939538 3:54358801-54358823 ACTAAAAGTCAAAAGGTAGAGGG + Intronic
956303559 3:67798896-67798918 ACTAATATCCAGAATGTACAAGG - Intergenic
956951305 3:74286636-74286658 ACCAATATTCAAAGGGAAAAAGG + Intronic
957798871 3:85048908-85048930 AGTAGTATTCAGAGGGAAAATGG + Intronic
957872241 3:86104274-86104296 ACTAATAAAAAGAGGGAAGAGGG - Intergenic
958827274 3:99046265-99046287 ACTAATATTTAGAGTATACAAGG + Intergenic
959034562 3:101346031-101346053 ACTAATATTCAGAATCTACAAGG + Intronic
959719046 3:109466790-109466812 ACTAATATGCAGAGTCTACAAGG + Intergenic
960306900 3:116072784-116072806 TCTAATATTCAGAGTCTACAAGG - Intronic
960754304 3:120993189-120993211 ACTAATATCCAGAGTATATAAGG - Intronic
964699383 3:159547293-159547315 TCTAATATTCAGAGTCTACAAGG - Intronic
965221188 3:165928305-165928327 ACAAATATACAGAGAGTATATGG - Intergenic
965408377 3:168299234-168299256 TCTAATTTTTAGAGGATAGAGGG + Intergenic
966296091 3:178425171-178425193 ACTAATATTCAGAATATACAAGG - Intronic
967114592 3:186325375-186325397 ACTATTATTCAGGGGGTACAGGG - Intronic
969164240 4:5292519-5292541 ACTAATATTCAGAATCTATAAGG - Intronic
969169917 4:5353511-5353533 ACTAATATCCAGAGTATACAAGG + Intronic
969851616 4:9961823-9961845 TCTAATATCCAGAGTCTAGAAGG + Intronic
970331621 4:14991882-14991904 AAAAACATTCAGAGGGAAGAGGG - Intergenic
970571845 4:17391150-17391172 TCTAATATTCAGAGTCTACAAGG - Intergenic
971149649 4:24018442-24018464 AATTTAATTCAGAGGGTAGATGG + Intergenic
971400441 4:26270734-26270756 TCAAACCTTCAGAGGGTAGAGGG - Intronic
971721346 4:30248744-30248766 ACTAATATTCAGAACGTACAAGG - Intergenic
972207637 4:36797414-36797436 ACTAATATTCAGAATATACAAGG + Intergenic
972380535 4:38515460-38515482 ACTAATATTTATATAGTAGATGG + Intergenic
973342614 4:49020934-49020956 ACTAATATCCAGAAGCTACAAGG - Intronic
974148223 4:57972476-57972498 ACTAAGGTTGAGAGGGTAAATGG - Intergenic
975375394 4:73637935-73637957 ACTAATATCCAGAATGTACAAGG + Intergenic
975616217 4:76250439-76250461 ACTAATATTCAGAATCTACAAGG - Intronic
975977954 4:80120846-80120868 ACTAATATCCAGAGTCTACAAGG + Intronic
976363635 4:84208857-84208879 ACTAATATTCAGAATCTACAAGG + Intergenic
976368442 4:84258543-84258565 ACTACTATTCAAATGTTAGAGGG - Intergenic
976941739 4:90710166-90710188 TCTAATATCCAGAGTCTAGAAGG - Intronic
977430188 4:96922202-96922224 TCTAATATCCAGAGGCTATAAGG - Intergenic
977433110 4:96957296-96957318 GAAAATATTCAGAGGGTAAAGGG + Intergenic
977437337 4:97015107-97015129 ACCAAGATGCAGAGGATAGATGG - Intergenic
978656465 4:111071016-111071038 ACTAATATTCTGAATGTAGTTGG - Intergenic
978925258 4:114234902-114234924 ACTAATATTCAGAATCTACAAGG + Intergenic
979324631 4:119364623-119364645 ACTAATTTTCAGCGGGTAACAGG + Intergenic
979506588 4:121503989-121504011 ACTAATATCCAGAGTCTACAAGG - Intergenic
980032975 4:127851792-127851814 ACTAATATTCAGAATGTGTAAGG + Intergenic
981177311 4:141696891-141696913 ACTAATATTCATAACGTACAAGG - Intronic
981277028 4:142912667-142912689 ACTAAGAGTCACAGGGTGGATGG + Intergenic
981447081 4:144852287-144852309 GCAAATATTCAGTGGTTAGAGGG - Intergenic
982950990 4:161695838-161695860 ACTAATATTCAGAATCTATAAGG - Intronic
983242472 4:165249323-165249345 ACTAATTTTCAGTGGGTAACAGG + Intronic
983778110 4:171633747-171633769 TCTAATATTCAGAAGCTATAAGG - Intergenic
986146591 5:5083552-5083574 ACCAACCTTCAGAGGGTAAAGGG + Intergenic
986626647 5:9729104-9729126 ACTCATACTCAGAGGTTAGCTGG + Intergenic
986909668 5:12539407-12539429 ACTAATATCCAGAGTCTATAAGG + Intergenic
986997753 5:13626517-13626539 ACTAATATCCAGAGTCTACAAGG + Intergenic
987081923 5:14432889-14432911 GCTAAAATTCACAGGGTTGATGG - Intronic
987415618 5:17658478-17658500 ACTAATATTCAGAATCTACAAGG - Intergenic
988647047 5:33105974-33105996 ACTTAAATTCAGAAGGTAAATGG - Intergenic
988934997 5:36072914-36072936 ACTAATATTCAGAAGCTATAAGG - Intergenic
989249684 5:39296281-39296303 ACTAATATCCAGAATTTAGAAGG + Intronic
989468209 5:41782625-41782647 ACTAATATCCAGAGTCTGGAAGG - Intronic
990228887 5:53688890-53688912 ACTAATATCCAGAGTCTACAAGG + Intergenic
990495887 5:56347398-56347420 GCAAACCTTCAGAGGGTAGAAGG + Intergenic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
990782469 5:59381125-59381147 ACTAGTATTCCGGGGGTTGATGG - Intronic
990871941 5:60441699-60441721 ACTAATATTCAGAATCTACAAGG + Intronic
991415765 5:66391316-66391338 ACTAATATTCAGAATCTATAAGG + Intergenic
992956199 5:81911123-81911145 ACTTATAGTCACAGAGTAGAGGG - Intergenic
993607123 5:90005401-90005423 ACTAATATCCAGAGTCTACAAGG + Intergenic
993744313 5:91577201-91577223 ACTAATACTCAGAGTCTACAAGG - Intergenic
993875623 5:93303442-93303464 AGGAATACTCAGAGGGTGGAGGG - Intergenic
994024442 5:95066116-95066138 ATTAATATCCAGAATGTAGAAGG + Intronic
994183758 5:96796571-96796593 ACTAAGTTTCAGAGGGAATAGGG + Intronic
994207556 5:97052019-97052041 ACTAATATCCAGAATCTAGAAGG - Intergenic
994327943 5:98470754-98470776 ACTAATATTCAGAATCTACAAGG + Intergenic
994398714 5:99251747-99251769 ACTAATATCCAGAGTCTACAAGG - Intergenic
994588937 5:101749174-101749196 GCTAATATTTAGGGGGTATATGG + Intergenic
995187598 5:109288574-109288596 ACTAATATTCAGAATCTACAAGG + Intergenic
996506129 5:124269539-124269561 GCTAATATTCAGAGTCTACAAGG - Intergenic
997682303 5:135765132-135765154 CCTAATATCCAAAGGGGAGATGG + Intergenic
997682510 5:135766192-135766214 TGTAATATTCAGGGGGAAGAGGG + Intergenic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
997685554 5:135785698-135785720 CATAATATCCAGAGGGGAGAGGG + Intergenic
997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG + Intergenic
998601025 5:143585181-143585203 ACTAATATTCAGAATCTACAAGG - Intergenic
999021905 5:148175225-148175247 ACTAAGATCCAGAGTGTAAAGGG - Intronic
999053747 5:148551553-148551575 ATTAATATTCAGAAGCTATAGGG + Intronic
999593438 5:153174436-153174458 ACTAATATTCAAAATGTATAAGG - Intergenic
1000263030 5:159607808-159607830 ACTAATATCCAGAATGTATAAGG + Intergenic
1000384502 5:160661525-160661547 AATAATTTGCAGAGAGTAGAGGG + Intronic
1000679622 5:164167209-164167231 TCTAATATTCAGAGTGAAGATGG - Intergenic
1000709711 5:164557063-164557085 ACTAATATTCAGAATCTATAAGG - Intergenic
1000893349 5:166825889-166825911 GCTAATATTCAGAAGGCACAGGG - Intergenic
1001134429 5:169090589-169090611 GGTAATATTCAGAGGGTTGAGGG - Intronic
1002250192 5:177924244-177924266 ACAAAAATTCAGAAGGTACAAGG + Intergenic
1002757331 6:174152-174174 ACTAATATCCAGAATGTACAAGG + Intergenic
1005047324 6:21654502-21654524 AGTAGTAGTCAGAGGGTAGGTGG + Intergenic
1005670088 6:28096938-28096960 TCAAATCCTCAGAGGGTAGAGGG + Intergenic
1005766182 6:29014601-29014623 ACTGGTATTGAGAGGGTATAAGG - Intergenic
1005880272 6:30052508-30052530 ACTAATATCCAGAGTGTACAAGG - Intergenic
1006274416 6:32990757-32990779 ACTAATATCCAGAATCTAGAAGG - Intergenic
1008231911 6:48993372-48993394 ACTAATATCCAGAGTCTATAAGG + Intergenic
1008298893 6:49809995-49810017 TCTAATATTCAGAGTCTACAAGG + Intergenic
1009046337 6:58241036-58241058 CCTAATATTCAGGGGGTAAGAGG + Intergenic
1009048587 6:58254800-58254822 TCTAATATTCAGAGGGTGAGAGG + Intergenic
1009049800 6:58262689-58262711 TCTAATATTCAGAGGGAAAGAGG - Intergenic
1009222152 6:60995353-60995375 CCTAATATTCAGGGGGTAAGAGG + Intergenic
1009224450 6:61009561-61009583 TCTAATATTCAGAGGGTGAGAGG + Intergenic
1009365990 6:62858232-62858254 TCTAATATTCAGAGGGAAAGAGG + Intergenic
1009369199 6:62879850-62879872 CCTAATATTCAGAGGGAAAGAGG + Intergenic
1011125175 6:83999583-83999605 ACTAATACACATAGGGAAGATGG - Intergenic
1011138291 6:84123832-84123854 ACTAATATTCATCAGGTACAAGG + Intergenic
1011214663 6:84992699-84992721 TCTAATATTCAGAGTCTACAAGG + Intergenic
1011225595 6:85102247-85102269 ACTAATATTCAGAATCTACAAGG + Intergenic
1012312161 6:97738834-97738856 GCTAATATCCAGAGGCTACAAGG + Intergenic
1012826157 6:104149813-104149835 ACTAATATCCAGAAGATACAAGG - Intergenic
1013195147 6:107838214-107838236 ACTATTATTAAGAGGATAGTAGG + Intergenic
1014059644 6:117056201-117056223 ACTAATATCCAGAGTATACAAGG - Intergenic
1014312933 6:119828246-119828268 ATTAATATTCAGAGTCTACAAGG - Intergenic
1014902331 6:126983135-126983157 ACTAATATTCAGAATCTATAAGG + Intergenic
1016461092 6:144280862-144280884 AAAAAAATTCAGAGGGTTGATGG + Intergenic
1017212007 6:151867377-151867399 GCTAATATCCAGAATGTAGAAGG + Intronic
1017555919 6:155568185-155568207 ACTAATATCCAGAATGTACAAGG - Intergenic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1020599393 7:10253107-10253129 TCTAATATTCAGAGTCTACAAGG + Intergenic
1020820357 7:12959371-12959393 ACTAGTATCCAGAGTCTAGAAGG - Intergenic
1023257851 7:38329605-38329627 TCTAATATCCAGAGGGGACATGG + Intergenic
1023270771 7:38459953-38459975 AATAATATTCAGAATGTACAAGG + Intronic
1023585196 7:41722551-41722573 ACTAAGATTTAGAGGGTTAAGGG - Intergenic
1024049057 7:45606580-45606602 ACTAAAAGTCAGAGGGAAGAAGG - Intronic
1024396504 7:48875221-48875243 AGACATATTCTGAGGGTAGATGG - Intergenic
1025001794 7:55321790-55321812 TCTAATATTCAGAGTCTACAAGG + Intergenic
1028318218 7:89430892-89430914 ACAAATACTCTGAGGGAAGAAGG - Intergenic
1028382866 7:90218145-90218167 ACTAATATTCAGAATATACAAGG - Intronic
1029084370 7:97999756-97999778 ACTAAATTTCAGAGATTAGATGG + Intergenic
1029324938 7:99798147-99798169 AATAATAATCAGAAGATAGAAGG + Intergenic
1029344104 7:99966276-99966298 CCTAATATTCAGGGGGGACAAGG - Intergenic
1030255204 7:107502888-107502910 ACTAGTATTCAGAAGCTACAGGG - Intronic
1030550978 7:110959263-110959285 AGTAATATCCAGAGGAAAGATGG + Intronic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1032878181 7:136060097-136060119 ATTAATGTTCAAAGGGCAGAGGG + Intergenic
1032891049 7:136195294-136195316 ACTAATATTCAGAATATACAAGG - Intergenic
1033638187 7:143232864-143232886 ACTAATATCCAGAGTCTACAAGG - Intergenic
1033769954 7:144538871-144538893 TCTAATATACAGAGGCTATAAGG + Intronic
1033923662 7:146428628-146428650 TCTAATATACAGAGGCTACAAGG - Intronic
1034711859 7:153199698-153199720 ACTAATATCCAGAATCTAGAAGG + Intergenic
1038855304 8:31324655-31324677 TCTAATATTCAGAGTCTACAAGG - Intergenic
1039005617 8:33033471-33033493 ACTAATATTCAGATTATAAAAGG + Intergenic
1040409074 8:47136504-47136526 ACTAATATGCAGAGTATACAAGG - Intergenic
1040623949 8:49123597-49123619 ACTAATATTCAGAATTTAAAAGG - Intergenic
1041129511 8:54682677-54682699 TCTAATATTCAGAGTCTACAAGG - Intergenic
1041586081 8:59521345-59521367 TCTAATATTCAGAATCTAGAAGG + Intergenic
1042682410 8:71400408-71400430 TCTAATATCCAGAAGGTACAAGG + Intergenic
1042981714 8:74536983-74537005 ACTAATATCCAGAGTCTACAAGG - Intergenic
1043035912 8:75198880-75198902 ACTAATATCCAGAGTATACAAGG - Intergenic
1043537345 8:81220403-81220425 ACTAATATTCAGAATCTACAAGG - Intergenic
1043551794 8:81381937-81381959 ACTAATATTCAGAATATACAAGG - Intergenic
1043721618 8:83551871-83551893 ACTAATATCCAGAAGCTATAGGG + Intergenic
1043871041 8:85433180-85433202 ACTAATATCCAGAATGTATAAGG - Intronic
1045951941 8:107862077-107862099 ACTAATATCCAGAGTCTACAAGG - Intergenic
1046119907 8:109832802-109832824 TCTAATATTCAGAATGTATAGGG + Intergenic
1046233009 8:111382381-111382403 ACTAATATTCAGAATCTACAAGG - Intergenic
1046633575 8:116646603-116646625 ACTAAAATTCAAAGGGAAAATGG + Exonic
1046810740 8:118530579-118530601 ACTAATATACAGAGCTTATAGGG - Intronic
1047383810 8:124389603-124389625 ACTAATATTCAGACTCTACAAGG - Intergenic
1048277604 8:133078801-133078823 ACCTATATTCAGAGGACAGACGG + Intronic
1048944586 8:139432558-139432580 AAAAATAATCTGAGGGTAGAAGG + Intergenic
1049149615 8:141026224-141026246 ACACATATTCACAGGGCAGAAGG + Intergenic
1051156653 9:14155383-14155405 ACTAACGTGCAGAGTGTAGAGGG - Intronic
1051559536 9:18424965-18424987 ACTAATATTCAGATCATAGGTGG - Intergenic
1051869309 9:21718053-21718075 ACTATTATTCAGAATGTACAAGG + Intergenic
1052628958 9:31012381-31012403 ACTAATATCCAGAGTTTACAAGG - Intergenic
1052922651 9:33984302-33984324 ACTAATATTCAGACAATACAAGG + Intronic
1055866712 9:80822974-80822996 ACTAATATTCAGAATCTACAAGG + Intergenic
1056039151 9:82643107-82643129 ACTAATATCCAGAATGTAGAAGG + Intergenic
1057285001 9:93745083-93745105 ACTAATATCCAGAAGCTACAAGG - Intergenic
1058344422 9:103943727-103943749 ACTAATATTGAGAGGTTTGGAGG - Intergenic
1058517924 9:105794576-105794598 CCTAATATTCAGCGGGGGGAGGG + Intergenic
1058519338 9:105803293-105803315 CCTAATATCCAGAGGGGAGAAGG - Intergenic
1058582140 9:106469941-106469963 ACTAATATTCAGAATCTACAAGG - Intergenic
1060256675 9:122036838-122036860 ACTACCTTTCACAGGGTAGAGGG + Intronic
1203490895 Un_GL000224v1:103420-103442 ACCAACATTCAGAAGGAAGAGGG + Intergenic
1203498124 Un_GL000224v1:172287-172309 ACAAATATTCAGAGGACAGTAGG + Intergenic
1203503519 Un_KI270741v1:45298-45320 ACCAACATTCAGAAGGAAGAGGG + Intergenic
1203510678 Un_KI270741v1:114537-114559 ACAAATATTCAGAGGACAGTAGG + Intergenic
1203618668 Un_KI270749v1:96466-96488 ACTAATATTCAGAATCTACAAGG + Intergenic
1185839937 X:3379612-3379634 ACTAATATTCAGAATCTACAGGG + Intergenic
1186409372 X:9332912-9332934 ACCCATCTTCAGAGGGTACAGGG - Intergenic
1186920874 X:14278750-14278772 ACTAATATCCAGAATGTACAAGG + Intergenic
1187108812 X:16274135-16274157 ACTAATATTCAGAATCTATAAGG - Intergenic
1188036768 X:25327010-25327032 TCTAATATTCAGAGTCTACAAGG - Intergenic
1188270166 X:28129268-28129290 TCTAATATTCAGAGTCTACAAGG - Intergenic
1188272161 X:28153306-28153328 ACTAATATCCAGAATGTACAAGG + Intergenic
1188927010 X:36056036-36056058 ACTAATATCCAGAGTGTACAAGG - Intronic
1189564191 X:42223015-42223037 ACTAATATTCAGAATATACAAGG - Intergenic
1190448201 X:50552306-50552328 AGTAATATTCATTGGGTAGTTGG + Intergenic
1191212207 X:57897694-57897716 ACTAGTATTCAGAGTATACAAGG + Intergenic
1191896498 X:65998687-65998709 AATAATATTCAGTGAGTAAATGG - Intergenic
1192588828 X:72342681-72342703 AATAATATTCAAAGAGTAGTTGG - Intronic
1192863333 X:75103002-75103024 ACTAATATTCAGAATATACAAGG - Intronic
1193190708 X:78566915-78566937 ACTAATATTCAGAATCTACAAGG - Intergenic
1193321398 X:80126132-80126154 ACTAATATTCAGAATCTATAAGG - Intergenic
1193446552 X:81611957-81611979 ACTAATATTCAGAATCTACAGGG - Intergenic
1193486772 X:82093682-82093704 ACTAATATCCAGAATGTACAAGG - Intergenic
1193506823 X:82354644-82354666 ACTAATATTCAGAATATATAAGG + Intergenic
1193580264 X:83255940-83255962 ACTAATATTCAGAATTTATAAGG + Intergenic
1193702992 X:84786375-84786397 ACTAATATTCAGAATCTACAGGG - Intergenic
1193778562 X:85674824-85674846 CCTAATATTCAGAATCTAGAGGG - Intergenic
1194028038 X:88778285-88778307 ACTAATATTCAGAATCTACAAGG - Intergenic
1194047553 X:89027315-89027337 ACTAATATTCAGAATCTACAAGG - Intergenic
1194170852 X:90578945-90578967 GCAAATCTTCAGAGGGTAAAAGG + Intergenic
1194263046 X:91721343-91721365 ACTAATATCCAGAAAGTACAAGG + Intergenic
1194587770 X:95757610-95757632 ACTAATATCCAGAGTCTACAAGG - Intergenic
1194922552 X:99784468-99784490 TATTTTATTCAGAGGGTAGAGGG + Intergenic
1195485546 X:105401031-105401053 ATTAATATTCACATGGCAGAAGG + Intronic
1196126227 X:112102700-112102722 ACTAATATCCAGAGTCTACAAGG + Intergenic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1196363655 X:114898282-114898304 TCTAATATCCAGAGTGTACAAGG - Intronic
1196477285 X:116102998-116103020 ACTAATATTCAGAATCTACAAGG - Intergenic
1196566218 X:117208012-117208034 ACTAATATCCAGAGTGTCAAAGG + Intergenic
1197492402 X:127134459-127134481 ACTAATATTCAGAATCTACAGGG - Intergenic
1197597576 X:128484519-128484541 ACTAATATCCAGAGTCTACAAGG - Intergenic
1197716130 X:129707212-129707234 TCTAAGAATCAGAGGGGAGAAGG - Intergenic
1197946987 X:131850091-131850113 ACTAATATTCAGAATATAAAAGG - Intergenic
1198063351 X:133070173-133070195 ACAAATATGAAGAGGGTAGAAGG + Intronic
1198267884 X:135027308-135027330 ACTAATATTCAGAATCTACAAGG + Intergenic
1198942857 X:141977108-141977130 ACTAATATTCAGAATCTACAAGG - Intergenic
1199425451 X:147695783-147695805 ACTAATATTCAGAACCTATAAGG + Intergenic
1199434742 X:147800921-147800943 ACTAATATCCAGAGTATACAAGG + Intergenic
1199658890 X:150026498-150026520 ACAAATATTCAGAGGAAAGTGGG + Intergenic
1199876935 X:151940008-151940030 GGTAATATTCAGAGGTTACAGGG - Intergenic
1200359480 X:155588596-155588618 ACTAATATCCAGAATCTAGAAGG + Intronic
1200517087 Y:4156683-4156705 GCAAATCTTCAGAGGGTAAAAGG + Intergenic
1201765805 Y:17572687-17572709 ACTAATAGCCAGAGGCTAGCTGG - Intergenic
1201835747 Y:18333302-18333324 ACTAATAGCCAGAGGCTAGCTGG + Intergenic