ID: 1112462214

View in Genome Browser
Species Human (GRCh38)
Location 13:99613195-99613217
Sequence CCAGGGAGCCCTTTTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 4, 3: 14, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112462214_1112462221 21 Left 1112462214 13:99613195-99613217 CCAAAAGAAAAAGGGCTCCCTGG 0: 1
1: 1
2: 4
3: 14
4: 202
Right 1112462221 13:99613239-99613261 AGCCAAGGAATGTGCCAGGAAGG 0: 1
1: 2
2: 4
3: 16
4: 250
1112462214_1112462219 6 Left 1112462214 13:99613195-99613217 CCAAAAGAAAAAGGGCTCCCTGG 0: 1
1: 1
2: 4
3: 14
4: 202
Right 1112462219 13:99613224-99613246 GTGTTCAGTGGTAGCAGCCAAGG 0: 1
1: 0
2: 1
3: 16
4: 182
1112462214_1112462220 17 Left 1112462214 13:99613195-99613217 CCAAAAGAAAAAGGGCTCCCTGG 0: 1
1: 1
2: 4
3: 14
4: 202
Right 1112462220 13:99613235-99613257 TAGCAGCCAAGGAATGTGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 180
1112462214_1112462217 -6 Left 1112462214 13:99613195-99613217 CCAAAAGAAAAAGGGCTCCCTGG 0: 1
1: 1
2: 4
3: 14
4: 202
Right 1112462217 13:99613212-99613234 CCCTGGCTGTATGTGTTCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112462214 Original CRISPR CCAGGGAGCCCTTTTTCTTT TGG (reversed) Intronic
901050895 1:6425393-6425415 CCAGGGAGCCCATTCACTTGAGG - Intronic
904140739 1:28351042-28351064 CCAGGAAGCCCATCTTCTTTTGG + Intergenic
906001710 1:42431967-42431989 GGAGGGAGCCCTTTTTGTGTGGG - Intronic
907048803 1:51316055-51316077 CCAGGGACCCCATTTCCTGTGGG - Intronic
908841418 1:68283961-68283983 GAAGAAAGCCCTTTTTCTTTAGG + Intergenic
909576277 1:77180280-77180302 CCAGTGCCCACTTTTTCTTTTGG - Intronic
911230790 1:95359607-95359629 CTCAGGAGCCCTTTTTCTTGTGG + Intergenic
912787438 1:112618764-112618786 CAAGTGAGTTCTTTTTCTTTTGG - Intronic
913595115 1:120368027-120368049 CCAGGGAGCCTATTTTCCTCAGG + Intergenic
914092156 1:144510959-144510981 CCAGGGAGCCTATTTTCCTCAGG - Intergenic
914306378 1:146422906-146422928 CCAGGGAGCCTATTTTCCTCAGG + Intergenic
914595670 1:149149896-149149918 CCAGGGAGCCTATTTTCCTCAGG - Intergenic
917534944 1:175867762-175867784 CCAGGGACCCCTATCTCCTTGGG - Intergenic
920041169 1:203098454-203098476 TCAGGGAGCCCCCATTCTTTAGG - Intronic
920561017 1:206938654-206938676 CCTGGGAACCCTTAGTCTTTTGG - Intronic
920660701 1:207911875-207911897 CAGGGAAGTCCTTTTTCTTTAGG - Intergenic
921305901 1:213796512-213796534 CCAAGTATCCCTTTTTCTCTTGG - Intergenic
922740695 1:228012769-228012791 CTAGGGAGCTTTTTCTCTTTGGG - Intronic
922901417 1:229139609-229139631 CCAGGGAGCCATCTCACTTTAGG - Intergenic
1063161594 10:3422565-3422587 CCTGGGAGCCCTGCTTCTTCAGG - Intergenic
1064321624 10:14310515-14310537 CCAGGTAGCCTTTTTCCTATTGG - Intronic
1064347995 10:14549922-14549944 CCAGTGAGCTCTTTGTTTTTAGG - Intronic
1068125753 10:52840296-52840318 CCAGGCTGCCCACTTTCTTTGGG - Intergenic
1071475363 10:86020749-86020771 CCAGGGAGGCCTTATCCTGTGGG - Intronic
1072693126 10:97584499-97584521 CCAGGGGGCCCTGTTCCTTCTGG - Exonic
1073692121 10:105820695-105820717 ACAGAATGCCCTTTTTCTTTGGG - Intergenic
1074024642 10:109621674-109621696 CTAGGGAGCCGTTGTTCTTGTGG - Intergenic
1074364878 10:112849853-112849875 CCAGGGCTGCCTTTTTCTGTGGG - Intergenic
1074775460 10:116765242-116765264 CCAAGGAGCCCATGTGCTTTTGG - Intergenic
1075390607 10:122088332-122088354 TCAGGGGGCCCTTTTTCCTAGGG + Intronic
1075934273 10:126326379-126326401 ACAGGGGGTCCTTTCTCTTTGGG + Intronic
1076910301 10:133384631-133384653 CAAGGGAGCCCTTCCTCTGTGGG - Intronic
1079082792 11:17425530-17425552 CCAGAGATCCCTTTTTCCCTTGG + Intronic
1079365980 11:19810372-19810394 CCAAGGATCCCTGGTTCTTTTGG + Intronic
1081830408 11:46106806-46106828 GCAGGCAGCCCTTTCCCTTTTGG + Intronic
1082167213 11:48963461-48963483 CCTGGGGTCCCTTTTTCTGTGGG - Intergenic
1086279316 11:85167700-85167722 ACAGGTTTCCCTTTTTCTTTAGG + Intronic
1087333736 11:96816103-96816125 CCAAGGAGCCCACTTTTTTTTGG - Intergenic
1088510639 11:110570159-110570181 CCTGGGAGATTTTTTTCTTTGGG + Intergenic
1088916570 11:114232313-114232335 GTAGGGAGCCCTTTGGCTTTAGG + Intronic
1090278971 11:125440008-125440030 CCAGGGAGCCCTGGTGCTTGCGG - Intergenic
1090808034 11:130215093-130215115 CCAATGAGTCCTCTTTCTTTTGG + Intergenic
1091086199 11:132724214-132724236 CCAGGGTGTCCTTTATGTTTTGG - Intronic
1092623122 12:10295490-10295512 CCAGGTATCCCATTTTTTTTTGG + Intergenic
1092636612 12:10457814-10457836 CCAGTCAGCCCCTTTTCTATTGG - Intergenic
1092690694 12:11106992-11107014 CCAGTGAGACCTTCTTTTTTGGG + Intronic
1093183395 12:15992472-15992494 CCAGGGAGAACTTTTTGCTTTGG + Intronic
1099509544 12:83517219-83517241 CCAAGGACCCCTTTTGCTTCTGG - Intergenic
1100027566 12:90148510-90148532 CCAGGTTTCCCTGTTTCTTTGGG + Intergenic
1106809843 13:33349486-33349508 CCATGGAGCCCTCTTTCTGTAGG - Intronic
1107740563 13:43445763-43445785 CCAGGAGGCTCTTTTGCTTTTGG - Intronic
1108329773 13:49373600-49373622 CCAGTGAGCCATTTTTCTGAAGG - Intronic
1109174755 13:59141700-59141722 CCTGTGAGCCCTTGTTCCTTGGG + Intergenic
1109914910 13:68970467-68970489 CCAGGTAGGTCTATTTCTTTTGG - Intergenic
1111911813 13:94321661-94321683 CTAGGAAGCCCTATTTCATTGGG + Intronic
1112462214 13:99613195-99613217 CCAGGGAGCCCTTTTTCTTTTGG - Intronic
1112537507 13:100274693-100274715 CCAGGGTTCCCGTTTTCTGTAGG + Intronic
1113343023 13:109445947-109445969 TGGGAGAGCCCTTTTTCTTTAGG + Intergenic
1118301888 14:64623730-64623752 CCAGGGAGCCTTTATTCTCTAGG + Intergenic
1118882287 14:69840116-69840138 CCAAGGAGCCCTGGTTCCTTTGG + Intergenic
1118975656 14:70673978-70674000 CCAGGTAGCTTTTTCTCTTTGGG - Exonic
1119481709 14:74962134-74962156 CCAGGGAGACCTTCTTCCTCAGG + Intergenic
1119576981 14:75733368-75733390 GCAGGGAGGCCTCTTGCTTTTGG + Intronic
1121258193 14:92546834-92546856 CCAGGGACACCTGTTGCTTTGGG - Intronic
1121464806 14:94108858-94108880 CCAGGGTGGCCTTTTTGTTTTGG + Intronic
1121506447 14:94481425-94481447 CCAAGGTGCCCTTTCTCTTTGGG - Intergenic
1125357470 15:38831470-38831492 CCAGGCAGCCTTTTTCCATTTGG + Intergenic
1126276732 15:46892809-46892831 CCAGGAAGCTTTTTTACTTTAGG - Intergenic
1126459508 15:48900205-48900227 CCATAAAGCCCTTCTTCTTTAGG - Intronic
1127015783 15:54686033-54686055 CCAAGGAGCCCTAGTTCTATTGG - Intergenic
1129951999 15:79600204-79600226 CCAGGGAATCCTTTTTCTAATGG + Intergenic
1131963120 15:97809794-97809816 CCAGTGAGCCATGCTTCTTTGGG + Intergenic
1133362853 16:5187678-5187700 CCAGGTAGCCCATTTCCTGTTGG + Intergenic
1135646046 16:24162895-24162917 CCAGGTACACCTTTGTCTTTGGG - Intronic
1137547043 16:49411555-49411577 CCAGGCAGCCCCTTCCCTTTGGG - Intergenic
1137794645 16:51205361-51205383 CCAAGGAATCCTTTTTGTTTGGG - Intergenic
1139876413 16:70149606-70149628 CAAGGAAGCTCTTTTGCTTTAGG - Intronic
1140855249 16:78972168-78972190 CCAGGGAGCCCAGTTTCATCTGG - Intronic
1143836778 17:9699291-9699313 CCAGGGAGCCCTGATGCATTGGG - Intronic
1146673977 17:34760405-34760427 CCCCTGAGCCCTTTTCCTTTTGG - Intergenic
1150519950 17:65855640-65855662 CCAGGGAGCCCATTTTCCCCTGG - Intronic
1151696379 17:75720298-75720320 CCAGGGCTCCATTTTTCTCTAGG - Intergenic
1152149289 17:78588967-78588989 CCTGGGAACCTTTTCTCTTTAGG + Intergenic
1152320895 17:79608456-79608478 CCAGGTTCCCTTTTTTCTTTGGG + Intergenic
1152329861 17:79666375-79666397 CCAGGGAGCCCCATGTCTGTTGG - Intergenic
1152777672 17:82212887-82212909 CCAGGGACCCCGTTTCCTGTCGG - Intergenic
1152970883 18:159423-159445 CCAGGGATCACTTTTACTTAGGG + Intronic
1155448900 18:25943053-25943075 CCAGGTAGCCCCTTTCCTATTGG - Intergenic
1156075719 18:33276578-33276600 CCTTGGAAACCTTTTTCTTTTGG - Intronic
1156460246 18:37317701-37317723 TCAGGGAGCTCTTTTTTCTTTGG - Intronic
1158917994 18:62155680-62155702 CCAGTCAGACCTTTTTATTTGGG - Intronic
1164390660 19:27817442-27817464 ATAGGGAGCCCTTTTTCCATTGG + Intergenic
1164821050 19:31251530-31251552 CCAGGGAATCCTTTATCTTCTGG - Intergenic
1167304457 19:48699163-48699185 CCAGGTTTCCCTGTTTCTTTAGG - Intronic
1167899328 19:52606902-52606924 CAAGGTAGCCCCTTTTCTATTGG + Intronic
1168723408 19:58567664-58567686 CCAAGGAGACCCTTTTCTTAGGG - Intronic
925695791 2:6577062-6577084 CCAGGGAGCCCACTCTCCTTTGG - Intergenic
926684535 2:15688875-15688897 CCAGGGAGCCCAGTATCATTTGG + Intergenic
927054309 2:19355575-19355597 CCAGGAAGGCCTCTTTCCTTAGG - Intronic
927055612 2:19363161-19363183 GCAGGGGGCACGTTTTCTTTAGG - Intergenic
929324931 2:40598388-40598410 ACAAGGAGGCCGTTTTCTTTTGG - Intronic
932429253 2:71664162-71664184 CCAGGGAGTCTTCTTTCCTTGGG - Intronic
934952049 2:98583325-98583347 TCAGGGATCACTTTTTTTTTTGG - Intronic
936813571 2:116432695-116432717 GCATGTAGCCCTTTTTGTTTTGG - Intergenic
940199021 2:151129576-151129598 TCAGGGTGGTCTTTTTCTTTGGG - Intergenic
940764797 2:157778694-157778716 TCAGGTAGCCCTTTCTCTTAAGG - Intronic
942077992 2:172374531-172374553 CCAGGTTGCACTTTTTATTTTGG + Intergenic
942202256 2:173583037-173583059 AGAGGGAACCATTTTTCTTTAGG - Intergenic
943674694 2:190705369-190705391 CCAGGAAGCCCTTTTTTTGCTGG - Intergenic
943795261 2:191984771-191984793 CCAAAGAGCCCTTATCCTTTTGG + Intronic
944674740 2:202025851-202025873 CCGGGGAGACATCTTTCTTTTGG - Intergenic
946449780 2:219769959-219769981 CTAGGGACCCCTTTACCTTTGGG + Intergenic
946616164 2:221513022-221513044 TCAGGGGGCACCTTTTCTTTCGG - Intronic
1169271781 20:4205590-4205612 CCAGGTAGCCCCTTTCCTATTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1174089887 20:48038452-48038474 TCATGGAGCCCTTTTCCCTTTGG - Intergenic
1175277986 20:57784837-57784859 GCAGGGAGCCATTTTTCCTTGGG + Intergenic
1175522396 20:59610318-59610340 CAATGGACCCCTTTGTCTTTAGG + Intronic
1177068404 21:16469035-16469057 ACACTGAGCCCTTTTTCTTTTGG - Intergenic
1177932071 21:27297587-27297609 CCAGTGAGTTCTTTTTCTTCTGG + Intergenic
1179060581 21:37975274-37975296 GCAGAGAGCCCCTTTTCCTTTGG - Intronic
1181456401 22:23062477-23062499 CCAGGGAGCCCTTTCTTTTTAGG - Intronic
1182933186 22:34194453-34194475 CCATGGAGCCATTTTTTCTTTGG - Intergenic
1183709604 22:39495134-39495156 CCAGGGAGTCCTCTTTCCTAAGG + Intergenic
1185121646 22:48974993-48975015 CCAGGGGACCCTTTGTCTCTGGG - Intergenic
949516146 3:4808719-4808741 ACAGGCAGCCCGATTTCTTTTGG - Intronic
949748211 3:7320330-7320352 ACAGGTTTCCCTTTTTCTTTTGG - Intronic
950124105 3:10501078-10501100 CCAGGGACCTCTGTTTCTTTAGG + Intronic
951708723 3:25568795-25568817 CCAGGGAGTCCATGTTCTCTGGG - Intronic
952326408 3:32324352-32324374 CCAGGGAACCCTTTTTCTCTGGG - Intronic
952429624 3:33210350-33210372 CCAGTGAGCCGTTTTGCTTTGGG - Intronic
952977516 3:38708841-38708863 CCATGTAGCCCCTTTTCTCTCGG + Intronic
954190335 3:48955368-48955390 CCCTGGATCCATTTTTCTTTTGG + Intronic
955352585 3:58204788-58204810 CCAGGGAGCCCTTTGTGGTCTGG - Exonic
956210845 3:66799699-66799721 CCATGGAGCCATTTTTCTCTGGG + Intergenic
956254725 3:67271717-67271739 CCAGTGCTCCCTATTTCTTTTGG - Intergenic
959262498 3:104099484-104099506 CCAGTGGGACCTTTTTATTTTGG - Intergenic
960846190 3:122006469-122006491 CCAGGCAGCCCTTTAACTGTGGG - Intronic
961444648 3:126973524-126973546 CCAGGGAGCCCATCTTCTCAGGG - Intergenic
963429908 3:145187005-145187027 CCAGTTAACCCTTTTTCTTCTGG + Intergenic
964762833 3:160150733-160150755 CCAGGAAGCCCACTATCTTTAGG + Intergenic
966610869 3:181866906-181866928 CCCGGCAGACCTTTTTCTCTTGG + Intergenic
967598496 3:191356414-191356436 TCAGGGTTCCCATTTTCTTTTGG + Intronic
968506868 4:974762-974784 CCAGGCAGCCCTCATTCTTCAGG - Intronic
970212189 4:13721210-13721232 CCAGGGAGGCCTTTTGTCTTTGG + Intergenic
971539731 4:27800972-27800994 CCAGGGAGCCTCTTTACTTGAGG - Intergenic
971751544 4:30656093-30656115 CCACATAGCACTTTTTCTTTGGG + Intergenic
975315756 4:72951270-72951292 CAAAAGAGCCCTTTTTCTATTGG - Intergenic
976308096 4:83581585-83581607 CCAGAGAGCCCTTTTTCCATGGG - Exonic
977348471 4:95848181-95848203 CCAGTGAGCCCTTTTTCTTTTGG - Intergenic
979040675 4:115789179-115789201 CCAGGGAGCTCTTGGTCCTTTGG - Intergenic
979858301 4:125662077-125662099 CCAGGCAGCAATTGTTCTTTGGG + Intergenic
980828381 4:138099589-138099611 ACAGTCAGCCCTTTGTCTTTGGG - Intergenic
983461476 4:168029625-168029647 ACAATGAGACCTTTTTCTTTTGG - Intergenic
984162592 4:176272481-176272503 CCAGGGAGCGTTTCTTCTTGAGG - Intronic
986267965 5:6206615-6206637 CCATTGAGCTCATTTTCTTTTGG + Intergenic
989427143 5:41309061-41309083 ACAATGTGCCCTTTTTCTTTAGG + Exonic
990025103 5:51178550-51178572 CCAGGGAGCACTTTAACTTCTGG + Intergenic
991477175 5:67035086-67035108 TAAAGGAGTCCTTTTTCTTTTGG + Intronic
993353370 5:86877032-86877054 CCAGGTAGCCAATTTTCTATTGG - Intergenic
993966309 5:94364917-94364939 CCAGGTAGCCCCTTTCCTATTGG - Intronic
994117299 5:96074959-96074981 CCCAGGATACCTTTTTCTTTAGG + Intergenic
994994761 5:107045883-107045905 CCAGGGAGTAGATTTTCTTTTGG - Intergenic
995556372 5:113333381-113333403 CCAAGCAGCCTTTTTACTTTAGG - Intronic
995929951 5:117428729-117428751 CCAGGTTGCCTTCTTTCTTTAGG + Intergenic
997357960 5:133276431-133276453 CCAGGGAGCCCTTAGCCTTATGG + Intronic
1001759368 5:174194740-174194762 CCAGCCAGCTCTTTTCCTTTTGG + Intronic
1004651812 6:17617209-17617231 CCAGGGTGCCCTTTTCCCCTTGG - Intronic
1006581338 6:35079399-35079421 CCAGGGGGCCCTCTGTGTTTGGG - Intronic
1006941158 6:37753252-37753274 CCAGGCAGCCCTTTTTATTTTGG + Intergenic
1007778776 6:44239064-44239086 CCAGGCATCCCTTTTTCTCTTGG - Intergenic
1008819068 6:55609157-55609179 TCAGGGAGCCCTGTTGTTTTAGG - Intergenic
1011470165 6:87701173-87701195 ACAGGGACATCTTTTTCTTTGGG - Intronic
1011701610 6:89960316-89960338 CCAGGCAGCCCTGTGACTTTGGG - Intronic
1014979139 6:127925932-127925954 CCAAAGAACCCTTGTTCTTTTGG - Intergenic
1016530645 6:145054984-145055006 CCAGGAATCCCATTTTCTTCAGG - Intergenic
1017492377 6:154955825-154955847 CCATGAAGCCCTATTTCTTATGG + Intronic
1017654353 6:156613534-156613556 CCTGTGATCCCTTTTTTTTTTGG - Intergenic
1018420254 6:163634854-163634876 CCATGCAGCCCTTTCTCCTTAGG + Intergenic
1018618180 6:165707812-165707834 CCTGGGTGCTCTTTTCCTTTAGG + Intronic
1018927648 6:168217546-168217568 CCAGGCACCCCTTTTTCATCAGG - Intergenic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1020990964 7:15195621-15195643 CCAGGTAGCCCCTTTCCTATTGG + Intergenic
1022126668 7:27364351-27364373 CCAAAGAGACCTTTTTCGTTTGG + Intergenic
1024047608 7:45595962-45595984 GCAGGGAGCCTTGTCTCTTTGGG + Intronic
1024096299 7:45985443-45985465 CAAAGGAGCCCTTTTTTCTTGGG + Intergenic
1025858518 7:65305331-65305353 TCAGGGGTCCCTTTTTCTTCGGG - Intergenic
1026214753 7:68338395-68338417 CCAGGTAGCCCCTTTCCTATTGG + Intergenic
1026220536 7:68392586-68392608 CCAGGTAGCCCCTTTCCTATTGG + Intergenic
1026256675 7:68718260-68718282 CCAGACAGCCTTTTTTCTTCTGG - Intergenic
1027751995 7:82161025-82161047 ACAAGGTGCCCTGTTTCTTTGGG - Intronic
1028504899 7:91560119-91560141 CCACAGAGCCCATTTTATTTGGG + Intergenic
1031652136 7:124303929-124303951 CCTGTGACCCCTTTTTTTTTTGG + Intergenic
1034077773 7:148249301-148249323 CCAGGGAGCCCTTGGCTTTTAGG + Intronic
1037542004 8:19881000-19881022 CCAGGAAGCCCATTTTTTTCTGG + Intergenic
1038533924 8:28340239-28340261 CCAGCGTGCCATTTTTGTTTTGG + Intronic
1039078997 8:33717734-33717756 CGAGGGAGGCCTTTTTATCTGGG + Intergenic
1040490637 8:47918563-47918585 CCAAGGAGCCATGTTCCTTTTGG - Intronic
1041597737 8:59676879-59676901 CCAGGTAGCCCCTTTCCTATTGG - Intergenic
1044360441 8:91277146-91277168 TCAGGAACCCCTCTTTCTTTGGG + Intronic
1044828537 8:96222105-96222127 GCAGGAAGCCCTGGTTCTTTAGG - Intergenic
1048530118 8:135240245-135240267 CCAGTCAGCCCCTTTTCCTTGGG - Intergenic
1050122929 9:2326277-2326299 CCAGGGAGGAATTTTTCTTGAGG + Intergenic
1051434539 9:17016910-17016932 CCAGGGACCCCTTTATACTTAGG + Intergenic
1053542348 9:38987308-38987330 CCTGGGAGTCTTATTTCTTTTGG - Intergenic
1053806800 9:41810826-41810848 CCTGGGAGTCTTATTTCTTTTGG - Intergenic
1054623793 9:67376601-67376623 CCTGGGAGTCTTATTTCTTTTGG + Intergenic
1057189909 9:93081238-93081260 TCTGGGAGCCCTGTTTCTGTGGG + Intronic
1057262356 9:93592160-93592182 CCCAGGAGCCCTTTTTCACTGGG + Intronic
1058139215 9:101340343-101340365 CCAGGCAGCCCTTTTTCCTTTGG - Intergenic
1058601940 9:106679661-106679683 CCAGGGAGCCTGCTTTATTTTGG + Intergenic
1058856676 9:109069291-109069313 CCAGAGGGCTCCTTTTCTTTGGG - Intronic
1059109701 9:111544060-111544082 CAAGGGAACTCTTTTTCTTTTGG + Exonic
1059450794 9:114370434-114370456 CCAGGAAGCCCTTTTGTTTCAGG + Intronic
1060960298 9:127676066-127676088 CCTAGGGGCCCTTTTTGTTTGGG + Intronic
1187344328 X:18449153-18449175 CCTGAGAGCCTGTTTTCTTTGGG + Intronic
1188365897 X:29314667-29314689 CCAGTGGCACCTTTTTCTTTTGG + Intronic
1189175423 X:38952274-38952296 CGATGGCTCCCTTTTTCTTTTGG + Intergenic
1195328219 X:103775271-103775293 CCAGAGATCCTTTTTTCTTGGGG + Intronic
1198089609 X:133314815-133314837 CAGGGGAGACCTGTTTCTTTAGG - Intronic
1199513453 X:148649058-148649080 CTATGGAGCTCTTTTTCCTTTGG + Intronic
1200050102 X:153424645-153424667 CCTGGGACCCCTTTGTCTTTGGG + Intergenic