ID: 1112465894

View in Genome Browser
Species Human (GRCh38)
Location 13:99644516-99644538
Sequence AATAACTACAAGAGTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3222
Summary {0: 1, 1: 114, 2: 599, 3: 1108, 4: 1400}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112465894 Original CRISPR AATAACTACAAGAGTATAAC TGG (reversed) Intronic
Too many off-targets to display for this crispr