ID: 1112466178

View in Genome Browser
Species Human (GRCh38)
Location 13:99646890-99646912
Sequence ACTGAGAAGTAGCTATCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112466178_1112466184 11 Left 1112466178 13:99646890-99646912 CCCTGCGATAGCTACTTCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1112466184 13:99646924-99646946 CAGACACTCTTCTAGGCCCAGGG 0: 1
1: 4
2: 19
3: 122
4: 669
1112466178_1112466189 29 Left 1112466178 13:99646890-99646912 CCCTGCGATAGCTACTTCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1112466189 13:99646942-99646964 CAGGGATACAGCAGGGAGAGAGG 0: 1
1: 0
2: 2
3: 65
4: 625
1112466178_1112466186 22 Left 1112466178 13:99646890-99646912 CCCTGCGATAGCTACTTCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1112466186 13:99646935-99646957 CTAGGCCCAGGGATACAGCAGGG 0: 1
1: 1
2: 2
3: 27
4: 251
1112466178_1112466181 4 Left 1112466178 13:99646890-99646912 CCCTGCGATAGCTACTTCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1112466181 13:99646917-99646939 TCTGTGCCAGACACTCTTCTAGG 0: 1
1: 16
2: 145
3: 815
4: 2798
1112466178_1112466183 10 Left 1112466178 13:99646890-99646912 CCCTGCGATAGCTACTTCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1112466183 13:99646923-99646945 CCAGACACTCTTCTAGGCCCAGG 0: 2
1: 7
2: 46
3: 344
4: 1271
1112466178_1112466185 21 Left 1112466178 13:99646890-99646912 CCCTGCGATAGCTACTTCTCAGT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1112466185 13:99646934-99646956 TCTAGGCCCAGGGATACAGCAGG 0: 1
1: 1
2: 2
3: 31
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112466178 Original CRISPR ACTGAGAAGTAGCTATCGCA GGG (reversed) Intronic
903766990 1:25741403-25741425 ACTGGGAAGAAGCCATCCCAGGG + Intronic
905852481 1:41284192-41284214 ACTGAGTGGTGCCTATCGCATGG - Intergenic
906054809 1:42907222-42907244 ACTCAGAAGTGGCTATCGGCAGG + Intergenic
906838296 1:49108151-49108173 TCAGAGAAGTAGCTATGGAATGG - Intronic
907957840 1:59247943-59247965 ACTGAGAAGCAGCAAGCTCATGG - Intergenic
920960927 1:210663480-210663502 TCGGAGAAGTAGCTTTCCCAAGG - Intronic
921506814 1:215981761-215981783 AATGAGATGTAGCTGTAGCAAGG + Intronic
923663370 1:235977970-235977992 ACTGAGCAGTAGTTATGGCCTGG + Exonic
924210857 1:241765813-241765835 AATGATAAATAGCTATCACAGGG + Intronic
1065426341 10:25608330-25608352 ACTGAGCAGCAGCCATAGCATGG + Intergenic
1066436543 10:35401187-35401209 CCTGAGAAGGAACTATCACAAGG - Intronic
1071436263 10:85650643-85650665 ACAGAGAAGTAGCTAACCCATGG + Intronic
1071909977 10:90220477-90220499 AATGAGAAGAAGCTTTCCCAAGG + Intergenic
1074774531 10:116757312-116757334 AGGGAGAAGCAGCTCTCGCATGG + Intergenic
1075267568 10:121016175-121016197 ACTAATAAGTAGTTATAGCAAGG + Intergenic
1075532313 10:123240126-123240148 TCTGAGAAGTAACTATAGTAAGG + Intergenic
1085322590 11:75583854-75583876 ACTGGGAAGTGGCTGCCGCAGGG + Intergenic
1088430248 11:109750765-109750787 ACTGATAAGTATTTATGGCATGG + Intergenic
1089966832 11:122660246-122660268 ACTGAGAAGTGGCGATTTCACGG + Intronic
1097930486 12:65178715-65178737 ACTGAGAAGTAACTCGCCCAGGG + Intronic
1099158248 12:79207241-79207263 ACTGAAAAGGAGCTATCGATGGG + Intronic
1100161425 12:91865304-91865326 AGTGAGAAGTAGTTTTCTCAGGG - Intergenic
1107268428 13:38584906-38584928 ACTGAGATGTATCTCTCACATGG - Intergenic
1107443681 13:40450740-40450762 ACTGAGAAGTAGTCATCACTGGG + Intergenic
1111691832 13:91573308-91573330 ACTTAAAAGTAGCTGTCGTAAGG - Intronic
1112466178 13:99646890-99646912 ACTGAGAAGTAGCTATCGCAGGG - Intronic
1115789333 14:36861396-36861418 ACTCAAAAGTAGCTTTCCCATGG + Intronic
1117453212 14:55872480-55872502 ACTGAGAAGTTGCCAACCCAAGG - Intergenic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1137830137 16:51536496-51536518 ACTGGGAAGTAGATAGGGCATGG + Intergenic
1139125145 16:64068794-64068816 AATGAGATTTAGCTATTGCAGGG - Intergenic
1140355710 16:74304168-74304190 ACTGAGAATTTTCTATGGCAAGG - Intronic
1155643555 18:28049640-28049662 ACTGAATAGTATCTATGGCAAGG + Intronic
1155996983 18:32340800-32340822 AGTGAGAACTAGATATCCCAAGG + Intronic
1165302597 19:34980282-34980304 ACTGAGAACTAGCTAAAACAGGG - Intergenic
1165591656 19:36974007-36974029 ACAGAGAAGTGGATATAGCAGGG - Intronic
1165814494 19:38633261-38633283 ACTGAGAAGGAGCCACCGGAGGG + Intronic
931560061 2:63551392-63551414 AGTGAGAACTTGCTATCTCAAGG - Intronic
940923265 2:159334043-159334065 ACTGAGAAATAACAATTGCAAGG + Intronic
945232433 2:207606629-207606651 AGAGAGAAGTAGCTTTCTCAAGG - Intronic
945386747 2:209209905-209209927 ATTGAGAACTAGCTAACACATGG + Intergenic
1172502399 20:35436719-35436741 AGTGAGAAGGAGCTTTCCCAAGG + Intronic
1177555005 21:22677845-22677867 AATCAGAAGTAGATATCACAGGG + Intergenic
1179263405 21:39778806-39778828 CCTGAGAAGTAGATAAGGCAGGG - Intronic
1179281961 21:39941377-39941399 CCTGGGAAGCAGCTATCCCAAGG - Intergenic
950700458 3:14742015-14742037 ACTGAGGATTAGCTAAAGCAGGG - Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
955852211 3:63232674-63232696 TCTGAGAGGTAGCTAGCTCAAGG - Intronic
958737537 3:98026464-98026486 ACTGAGAAGTAGGTGTCACAGGG - Intronic
959411861 3:106034255-106034277 ACAAAGAATTAGCTATCGCTTGG - Intergenic
963185382 3:142410002-142410024 ACTGATAAGTAACTTTAGCAAGG - Intronic
963331681 3:143922472-143922494 ACTGAGAAGTGGCTGTAGCCAGG + Intergenic
966503270 3:180670812-180670834 ATTGAGAACTAGCTAAAGCAGGG + Intronic
971937846 4:33175848-33175870 ACTGAGAACTTGCTATAGCAAGG + Intergenic
973534101 4:51863863-51863885 ACTGGGAAGAAGCTATAACATGG - Intronic
978064480 4:104379396-104379418 GCTGGGAACCAGCTATCGCAAGG + Intergenic
988669115 5:33362037-33362059 ACTGAGAAGTATGTATGCCATGG + Intergenic
989457521 5:41660866-41660888 ACTCAGCAGTAGCTATAGCCAGG + Intergenic
991353582 5:65745490-65745512 ACAGAGAAGTAGCTTGCTCAAGG - Intronic
991562991 5:67974005-67974027 ACTGAGATATTGCTATGGCATGG - Intergenic
997192138 5:131946895-131946917 ATTAAGAAGTAGATATGGCATGG + Intronic
1000383182 5:160647371-160647393 ACTGCGGAGTAGCTAACCCATGG - Intronic
1006644507 6:35506542-35506564 TCTGAGAAGTAGGTATAGTAGGG + Intronic
1012563650 6:100618616-100618638 ACTGAGCAGTAGCAATAGCTGGG - Intronic
1015001497 6:128222057-128222079 ACTGAGAAATACATATGGCAGGG - Intronic
1036805503 8:11829742-11829764 AGTCAGAAATAGCTATTGCATGG + Intronic
1038752526 8:30309453-30309475 ACTGATAAGTAACTATAGCAAGG - Intergenic
1041383606 8:57277725-57277747 ACTGAGAAGTGGCTTTCTAATGG - Intergenic
1045887108 8:107111765-107111787 ACTGAGAAGTAGCTATATTATGG - Intergenic
1057991439 9:99774905-99774927 ACTGACAATTAGGTATAGCATGG - Intergenic
1060237522 9:121876274-121876296 ACAGAGAAGTAGATCTAGCAAGG + Intronic
1187877408 X:23815714-23815736 ACTGAAAATTAGTAATCGCAAGG - Intergenic
1188465389 X:30473761-30473783 ACTGAGAAATAGATAGGGCAAGG + Intergenic
1193297899 X:79853556-79853578 ACTGAGCAGTAGCTGTAGCCAGG - Intergenic