ID: 1112470694

View in Genome Browser
Species Human (GRCh38)
Location 13:99685997-99686019
Sequence CACTCTTATCACAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112470694 Original CRISPR CACTCTTATCACAGGGACGC AGG (reversed) Intronic
911171591 1:94776138-94776160 CTCTCTTACCTCAGGGAAGCGGG - Intergenic
912760277 1:112360192-112360214 TACTCTGACCACAGGGACACTGG - Intergenic
915116861 1:153606838-153606860 CTCTCTTATCACAGGGCCCAAGG + Intergenic
1062930117 10:1347300-1347322 CATTCTTGTCCCAGGGACGCCGG - Intronic
1063077916 10:2734847-2734869 AATTAATATCACAGGGACGCGGG - Intergenic
1063611873 10:7569667-7569689 GTCTCTGATCACAGGGACTCTGG - Exonic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1075051733 10:119187283-119187305 CACTGTTATCCCAGCTACGCAGG - Intergenic
1082279947 11:50260942-50260964 AACTTTTAACACAGGCACGCAGG - Intergenic
1083133331 11:60647374-60647396 CCCTCTTAGCACAGGGACAGGGG - Intergenic
1083993853 11:66262557-66262579 CACTCTGTACACAGGGACACAGG + Intronic
1088029296 11:105226892-105226914 AGCTCTTATCACATAGACGCTGG - Intergenic
1090794775 11:130125253-130125275 CACTCTGGTCCCAGGGAGGCTGG + Intronic
1092105216 12:5916984-5917006 AAGTCTGATGACAGGGACGCTGG + Intronic
1092766475 12:11857581-11857603 CACACTTATGACAGTGACACAGG + Intronic
1096171686 12:49476476-49476498 CTGTCTTATCACAGGGACAGAGG - Intronic
1096333350 12:50733968-50733990 CACTCTTATCACGGGGACTGTGG - Intronic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1096969115 12:55651446-55651468 CCCTCCCATCACAGGGCCGCAGG + Intergenic
1097643539 12:62209343-62209365 CACTCTTTTCACAAGGCAGCAGG - Intronic
1100005051 12:89885117-89885139 CACTGTTTTCCCAGGGACCCTGG + Intergenic
1101457213 12:104846738-104846760 CACACTTAGCACAGGGTAGCCGG + Intronic
1102842550 12:116141643-116141665 CACCCTCACCACAGGGACTCTGG + Intronic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1113118252 13:106897217-106897239 GAGTCTTATCAAAGGGACACAGG - Intergenic
1118127915 14:62929561-62929583 CACTCTTATCTCAGACACTCTGG + Intronic
1120967803 14:90183003-90183025 CACTCTCATCAGAGGGATGAGGG - Intronic
1129525440 15:76210829-76210851 CACTCTTTGCTCAGGGAAGCAGG - Intronic
1130303473 15:82698004-82698026 CATTCATATCTCAGGGAAGCTGG - Intronic
1137943202 16:52709067-52709089 CACACTTATCATAGGAAAGCTGG - Intergenic
1139119336 16:63996901-63996923 CATTATTATCACAGGGAGGTAGG + Intergenic
1141923288 16:87150710-87150732 CAATCTTACCACAGGGATGGGGG + Intronic
1142196766 16:88742606-88742628 CACTCTTGTCACAAGGAGCCGGG + Intronic
1146397482 17:32480316-32480338 CATTCTCATCACAGGGAAGAGGG - Intronic
1146601162 17:34217783-34217805 CACTCTGATGATAGGGAAGCTGG + Intergenic
1150584445 17:66504880-66504902 CACTCTTATGACAGGTCCACTGG - Intronic
1203165168 17_GL000205v2_random:87143-87165 AACTTTCATCACAGGGATGCAGG - Intergenic
1156360608 18:36381394-36381416 CACTCTGATCACTTGGACACTGG + Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
935274566 2:101464916-101464938 CACCCTTATCAGAGGGAAGTGGG - Intronic
935645150 2:105328912-105328934 AACACTTAACACAGGGAGGCAGG + Intronic
938960955 2:136341193-136341215 AACTCTTGTCACAGGGAATCTGG + Intergenic
940685565 2:156846242-156846264 CTCTGTTATCACAGTGACCCAGG - Intergenic
1169482222 20:5994637-5994659 CACTGTAATCACAGTGACTCAGG + Exonic
1171295668 20:24014684-24014706 CACTCTGATCCTAGGGCCGCTGG - Intergenic
1176406582 21:6371948-6371970 AACTTTCATCACAGGGATGCAGG + Intergenic
1184698366 22:46151694-46151716 CACCCTTATCCCAAGGAGGCTGG - Intronic
949275477 3:2274823-2274845 CAGCCTTATCACAGGGACATGGG - Intronic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
956624599 3:71254704-71254726 CACTCTTTTCACATGTACACTGG + Intronic
959069532 3:101689458-101689480 CACTGTTCTCACAGGGACAGAGG - Intergenic
961332362 3:126150082-126150104 CATTCTAATCACAGGGACATGGG + Intronic
961787032 3:129353473-129353495 AACTCCTATCAGAGGGAAGCTGG - Intergenic
963404462 3:144844435-144844457 CACTCTTATCACAGGCCCAGAGG - Intergenic
966169202 3:177058818-177058840 CACACTTATCAAAGGGACAATGG - Intronic
970042947 4:11817262-11817284 CTCTGTCATCACAGGGAAGCTGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
986738025 5:10682076-10682098 CACGCTTCTTGCAGGGACGCTGG - Intronic
989316065 5:40080153-40080175 CACTCTTCTCACTGGAATGCTGG + Intergenic
991002520 5:61796582-61796604 TACTCTTATCACAGGGCCTGGGG + Intergenic
991470130 5:66959175-66959197 CTCTGTCATCACCGGGACGCTGG + Intronic
999029154 5:148270785-148270807 GATTCTTATCAGAGGGAGGCAGG + Intronic
999560932 5:152801973-152801995 CACTTTTATCAAAGGGTCACTGG - Intergenic
1002278597 5:178118355-178118377 AACACTTATCACTGGGATGCTGG - Intronic
1002715305 5:181223472-181223494 GCCTCTTACCACAGAGACGCGGG + Exonic
1005741436 6:28794483-28794505 AACTTTTAACACAGGCACGCAGG - Intergenic
1006818134 6:36867565-36867587 CACACATATCACAGGGGCTCGGG + Intronic
1008739436 6:54587472-54587494 CATTCTTACCTCAGGGACGGGGG + Intergenic
1011067552 6:83344024-83344046 CACTGTTATCCCAGTGAAGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1028589284 7:92479198-92479220 GACTCTCTTCACAGGGACGGGGG - Intergenic
1030788948 7:113699307-113699329 ACATCTTATCACAGGGAAGCAGG + Intergenic
1031681958 7:124686407-124686429 GACTCTTATAAGAGGGAGGCAGG + Intergenic
1032906199 7:136370031-136370053 CACTCCTATCTCAGGGAGCCTGG - Intergenic
1039428421 8:37506026-37506048 TACTCTAATCACAGTGACCCAGG - Intergenic
1042348063 8:67747837-67747859 CTCTCTTCTAACAGGGACTCTGG - Intergenic
1044237857 8:89852572-89852594 CATTCTTAAAACAGGGAGGCAGG - Intergenic
1048516122 8:135113410-135113432 CTCTCTTATCACAGGGCCAGAGG + Intergenic
1048624829 8:136173591-136173613 CACTCTTACCACAGGCATGTAGG + Intergenic
1050989228 9:12126527-12126549 CACTCTAATCCCAGGTACTCGGG - Intergenic
1059784148 9:117562324-117562346 CACTCTTAACACAAAGACACTGG + Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1193400469 X:81036496-81036518 CTGTCTTATCACAGGGACAGAGG + Intergenic
1196649415 X:118153616-118153638 CATTCTTATTACAGGGATGTGGG + Intergenic
1198191244 X:134308833-134308855 CACTCTTACTACAGAGAAGCAGG - Intergenic