ID: 1112472376

View in Genome Browser
Species Human (GRCh38)
Location 13:99700625-99700647
Sequence CTTCGGGGCCCCTCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112472376_1112472381 3 Left 1112472376 13:99700625-99700647 CCAGCAGCTGAGGGGCCCCGAAG 0: 1
1: 0
2: 2
3: 17
4: 217
Right 1112472381 13:99700651-99700673 TGATGTCCCTTTCACGTTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 82
1112472376_1112472385 19 Left 1112472376 13:99700625-99700647 CCAGCAGCTGAGGGGCCCCGAAG 0: 1
1: 0
2: 2
3: 17
4: 217
Right 1112472385 13:99700667-99700689 TTGAAGGACCTCACTGGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 89
1112472376_1112472384 13 Left 1112472376 13:99700625-99700647 CCAGCAGCTGAGGGGCCCCGAAG 0: 1
1: 0
2: 2
3: 17
4: 217
Right 1112472384 13:99700661-99700683 TTCACGTTGAAGGACCTCACTGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112472376 Original CRISPR CTTCGGGGCCCCTCAGCTGC TGG (reversed) Intronic
900093963 1:932892-932914 CTCCTGGGCCCCTGAGCTGGTGG + Intronic
900196378 1:1378049-1378071 CTTTGGGGCTCCTCAGCTCAGGG + Intergenic
900410621 1:2510946-2510968 CTTCAGGGCCCCAGAGGTGCCGG + Intronic
900596091 1:3480841-3480863 TGGCTGGGCCCCTCAGCTGCTGG + Exonic
901193203 1:7424918-7424940 CTTCTTGTCCCCTCAACTGCTGG - Intronic
901634813 1:10665556-10665578 CACCGGGTGCCCTCAGCTGCAGG + Exonic
902653699 1:17853243-17853265 CTTTGGGGGCCCAAAGCTGCAGG + Intergenic
903467102 1:23559311-23559333 CTCAGCGGCTCCTCAGCTGCCGG + Exonic
904756802 1:32772395-32772417 CCTCTGGGCCCACCAGCTGCAGG - Exonic
905037901 1:34929557-34929579 CGGCGCGGCCCCTCAGCTGGGGG - Exonic
905070746 1:35223236-35223258 TTTCAGGGCCCCTCACTTGCAGG - Intergenic
905293666 1:36940644-36940666 CTGCCAGGCCCCTCAGATGCTGG - Intronic
905314902 1:37076183-37076205 TTTCAGGGCCCCAGAGCTGCTGG - Intergenic
908985201 1:70009486-70009508 CTTTGAGGCCCCTCATTTGCAGG - Intronic
913554215 1:119948799-119948821 CTTCGGGGCCCCCTAGCGGCTGG - Intronic
914879120 1:151534115-151534137 CCTCGAGACCCTTCAGCTGCCGG - Exonic
915142957 1:153778244-153778266 CTTCGGGCCCCTGCAGGTGCTGG + Exonic
917273679 1:173306409-173306431 CTTTGGGGCCCCTCAGGGACTGG + Intergenic
919063844 1:192668184-192668206 CTGACAGGCCCCTCAGCTGCAGG + Intergenic
921547200 1:216486428-216486450 CTGAGAGGACCCTCAGCTGCAGG - Intergenic
922393227 1:225169074-225169096 CTAAGAGGACCCTCAGCTGCAGG - Intronic
924568578 1:245218264-245218286 CTTAGGGTCCCCTCAGCAGATGG + Intronic
924801628 1:247332342-247332364 CTTCGGCGTCCCGCAGCGGCAGG - Intergenic
1062911048 10:1212667-1212689 ACTCAGGGCCTCTCAGCTGCAGG - Intronic
1062911080 10:1212799-1212821 ACTCAGGGCCTCTCAGCTGCAGG - Intronic
1065307675 10:24384049-24384071 CTTCTGGGCCACCCAGGTGCTGG - Intronic
1065364678 10:24923547-24923569 CTAACAGGCCCCTCAGCTGCGGG - Intronic
1067062306 10:43083724-43083746 CCTCTGTCCCCCTCAGCTGCTGG - Intronic
1068115697 10:52735592-52735614 CTTACAGGACCCTCAGCTGCAGG + Intergenic
1068789077 10:61008125-61008147 CATTCAGGCCCCTCAGCTGCAGG + Intergenic
1071333624 10:84584759-84584781 CTTTCGTGTCCCTCAGCTGCTGG + Intergenic
1071504111 10:86222532-86222554 CTTAGGGGCCACCCAGCAGCTGG + Intronic
1073197006 10:101699833-101699855 CCTCAGGGCCCCTCAGGAGCTGG + Intergenic
1075626184 10:123965941-123965963 CTCCAGGGCCCCTGACCTGCTGG - Intergenic
1076397715 10:130153543-130153565 CTAACGGGCCCCTCAGCTGCAGG + Intronic
1077500612 11:2908289-2908311 CTTCGGGGTGCTGCAGCTGCTGG + Exonic
1078697842 11:13652145-13652167 CTAACAGGCCCCTCAGCTGCAGG - Intergenic
1078723155 11:13902595-13902617 CTTTGAGGCCCATCAGGTGCTGG + Intergenic
1079291517 11:19192297-19192319 CCTGGGGGCCCCTCAGCATCCGG - Intronic
1084321021 11:68373433-68373455 TTACGTGGCCCCTGAGCTGCAGG + Intronic
1085133292 11:74060541-74060563 CTTTCAGGACCCTCAGCTGCAGG - Intronic
1085679677 11:78561406-78561428 CTTAGGAGCCCCTTTGCTGCGGG - Intronic
1086129308 11:83383864-83383886 CTAACGGGCCCCTCTGCTGCAGG - Intergenic
1089305543 11:117524137-117524159 CTTGGGGGCTCCTCAGCAGCAGG + Intronic
1089604973 11:119636452-119636474 CCTGGTGGCCCCTCAGCTCCAGG - Intronic
1089868762 11:121654405-121654427 CTTCTGGGAACCTCAGCTGTGGG + Intergenic
1090576278 11:128107954-128107976 CTAACAGGCCCCTCAGCTGCAGG - Intergenic
1090967514 11:131611930-131611952 CTTCAGGGACCCTCACCTCCTGG + Intronic
1101333691 12:103777846-103777868 CTTCGGAACCCCTCTCCTGCAGG - Exonic
1104410677 12:128555075-128555097 CTTCAGGGACTCTCTGCTGCAGG + Intronic
1104556190 12:129801462-129801484 CTGAGAGGACCCTCAGCTGCAGG - Intronic
1104949517 12:132432923-132432945 CTGCAGGGCCTCTGAGCTGCTGG - Intergenic
1104961794 12:132491588-132491610 TTTGGGGGACCCTCATCTGCTGG + Intronic
1104978286 12:132561756-132561778 CTTCTGGACCCCTCATCTGAGGG - Intronic
1105795576 13:23848942-23848964 CCTTGGGGCCCCTCAGATGTGGG - Intronic
1106153241 13:27126372-27126394 CTCACAGGCCCCTCAGCTGCAGG - Intronic
1107058440 13:36131018-36131040 CCTCGGCGCCCCGCGGCTGCGGG + Intronic
1109675834 13:65675049-65675071 CTAACAGGCCCCTCAGCTGCAGG + Intergenic
1110826415 13:79975929-79975951 CAGTCGGGCCCCTCAGCTGCAGG - Intergenic
1112131015 13:96524103-96524125 CTAACAGGCCCCTCAGCTGCAGG + Intronic
1112472376 13:99700625-99700647 CTTCGGGGCCCCTCAGCTGCTGG - Intronic
1113649625 13:112026606-112026628 CTGAGGGGCCCCTCTGCTGGAGG + Intergenic
1114603006 14:23970870-23970892 CTAACAGGCCCCTCAGCTGCAGG - Intronic
1114607367 14:24007996-24008018 CTAACAGGCCCCTCAGCTGCAGG - Intergenic
1115027197 14:28759241-28759263 CCCCGGTGCCCCTCAGCTGGGGG + Intergenic
1115034970 14:28846116-28846138 CAGTGAGGCCCCTCAGCTGCAGG - Intergenic
1118316950 14:64731339-64731361 GATTGGGGCCCCTCTGCTGCAGG + Exonic
1119027293 14:71164277-71164299 CTTCAGGGCCCATCACCTGCAGG + Intergenic
1119062421 14:71488946-71488968 ATTCCAGGCTCCTCAGCTGCAGG + Intronic
1121437082 14:93927289-93927311 CTGAGGGGCCCCCCAGCTCCGGG + Intronic
1122113061 14:99514990-99515012 CGTCCGGGCCGCTCTGCTGCAGG + Exonic
1122931206 14:104933724-104933746 CTCCCGGTCCCCTCAGCCGCGGG - Exonic
1122931248 14:104933827-104933849 CTCCCGGTCCCCTCAGCCGCGGG - Exonic
1124118293 15:26867477-26867499 CCTCGGGGCGCCTGAGCGGCAGG + Intronic
1125089599 15:35774794-35774816 CGCCGGGTGCCCTCAGCTGCAGG - Intergenic
1125226722 15:37404666-37404688 CTGAGAGGACCCTCAGCTGCAGG + Intergenic
1125504218 15:40257701-40257723 CATCAGGGCCCCACAGATGCAGG - Intronic
1126670668 15:51112629-51112651 CTTGTGGTCCCCTCAGCTTCTGG + Intergenic
1127342707 15:58065104-58065126 CTTCCGGGCCCCTCGGCTGTTGG - Intronic
1127722299 15:61715178-61715200 GCTCTGGGCCCCTCAGCAGCAGG - Intergenic
1128735266 15:70050013-70050035 CCTCGGGGCCCCTCGCCTGGGGG + Exonic
1131943432 15:97592850-97592872 ATTGGGGGACCCGCAGCTGCAGG - Intergenic
1132464676 16:72165-72187 CTCCTGGGACCCTCAGCTGTTGG + Intronic
1132513533 16:355191-355213 CCTCGGGGCCCCTGCCCTGCAGG + Intergenic
1133773881 16:8883425-8883447 CTGCGGGGTCCCACAGCTACGGG - Intergenic
1137437178 16:48465439-48465461 AGTCAGGACCCCTCAGCTGCAGG + Intergenic
1138612957 16:58141957-58141979 CTTCAGGGACCCTCACTTGCTGG - Intergenic
1139418127 16:66830836-66830858 CCTCGGCTCACCTCAGCTGCCGG + Exonic
1140482776 16:75271271-75271293 CTTCCAGGCCCCTCAGTTCCTGG + Intergenic
1141119443 16:81340529-81340551 CAGAGAGGCCCCTCAGCTGCAGG - Intronic
1141429674 16:83965196-83965218 GTCCTGGGCCCCACAGCTGCTGG - Exonic
1142125665 16:88409082-88409104 TCTGGGGGCCCCTCTGCTGCAGG + Intergenic
1142711771 17:1727434-1727456 CTTCGGGGCCACTCATCTGCAGG - Exonic
1146145415 17:30412104-30412126 CTAACAGGCCCCTCAGCTGCAGG + Intronic
1147136082 17:38434886-38434908 CTTCGGGGGCTCTCAGAAGCAGG - Intronic
1151453256 17:74212179-74212201 CTTCCGGGCCCCTCAGCTTTGGG + Intergenic
1154305704 18:13229261-13229283 CTCCTGGGCCCCTGTGCTGCCGG + Intronic
1160803124 19:979686-979708 CCTCTGAGGCCCTCAGCTGCGGG - Intergenic
1161101755 19:2424995-2425017 CTTGGGGTCCCCGTAGCTGCGGG - Exonic
1161299274 19:3535038-3535060 GGTCGGGGACCCTCAGCAGCAGG + Intronic
1161364773 19:3872041-3872063 CCTCTGGGCCCCCCAGCTTCCGG - Intergenic
1162031969 19:7921437-7921459 CTACGCGGCCCTTGAGCTGCTGG - Exonic
1162975744 19:14206386-14206408 CGTCGGGGCCGCGGAGCTGCGGG - Intergenic
1163683769 19:18699293-18699315 CTTCAGGGCCCCTCAACAGCCGG - Intronic
1164738825 19:30561742-30561764 CTGGAGGGACCCTCAGCTGCTGG - Intronic
1166369445 19:42292968-42292990 CTTGGGGGCCACTAAGCTGTAGG - Exonic
1166539994 19:43598925-43598947 CTTCGTGGCCCAGAAGCTGCAGG + Exonic
1167570053 19:50281332-50281354 CTGGGGAGCCCCTCGGCTGCTGG - Intronic
1167837431 19:52085647-52085669 CTGTCTGGCCCCTCAGCTGCAGG - Intronic
1167868046 19:52344236-52344258 CTCTCTGGCCCCTCAGCTGCAGG + Intronic
1167963167 19:53123500-53123522 CTCGCTGGCCCCTCAGCTGCAGG - Intronic
1167988865 19:53340904-53340926 CTCGCTGGCCCCTCAGCTGCAGG + Intronic
1168393221 19:56027664-56027686 CTGCGTGGCCCTGCAGCTGCAGG + Exonic
925161677 2:1688589-1688611 CTTGGGGTCCCCCAAGCTGCTGG - Intronic
925196372 2:1929230-1929252 CCTCGGCGCCCCTCAGCTGCCGG + Intronic
925376199 2:3387997-3388019 CCTCGGGGCCCCTCCGCTACTGG - Exonic
927028023 2:19090154-19090176 CTAACAGGCCCCTCAGCTGCAGG - Intergenic
927044204 2:19260940-19260962 CTTCTGGGACCCCCAGCTGTTGG - Intergenic
927176875 2:20415974-20415996 CTGCGGGGCCCCTGAGATGCCGG - Intergenic
933702270 2:85263893-85263915 CTAAGAGGCCCCTCAGCTTCTGG - Intronic
933721116 2:85398351-85398373 GTTCGGGGCCCCTGTGCTGCAGG - Intronic
937326747 2:120994002-120994024 CTTTGGGGACCTGCAGCTGCTGG - Intergenic
938067575 2:128289622-128289644 CGTCAGGGCCACACAGCTGCTGG - Intronic
942535195 2:176955951-176955973 TTCCAGGGTCCCTCAGCTGCTGG - Intergenic
945147345 2:206752515-206752537 CTCCCGGGTCCCTCAGCTGCAGG + Intronic
947435482 2:230068622-230068644 CTTGGAGCCCCCTGAGCTGCTGG + Exonic
1172427187 20:34863306-34863328 CTTCGGGGACCCCCAGGTGAGGG - Exonic
1173210743 20:41029478-41029500 CTCCGGGGCCCCCCAGCCGCCGG + Intronic
1173410936 20:42808900-42808922 CTGCAGGGGCTCTCAGCTGCCGG + Intronic
1173561165 20:44006627-44006649 CTTCGTGGTCCCCCAGGTGCAGG - Exonic
1175277250 20:57780658-57780680 CTTCTGGGCCCCTGTGCAGCTGG - Intergenic
1175951790 20:62587591-62587613 CTTTGGGGTTCATCAGCTGCGGG + Intergenic
1176030288 20:63008301-63008323 CCTCGGGGCCCCTGCGCTCCTGG - Intergenic
1178915090 21:36701496-36701518 CTTCCAGCCCCCTCCGCTGCCGG - Intronic
1181165006 22:20978529-20978551 GGTCTGGGCCCCTAAGCTGCAGG + Intronic
1181786605 22:25231682-25231704 CTTTGGGGCCCCTCACCCCCAGG + Exonic
1181960918 22:26621305-26621327 CTTCAGGTCCCCTGAGCTCCAGG + Intergenic
1183063036 22:35347117-35347139 CCCGGGGGCCCCTCAGCTGAGGG - Exonic
1183829476 22:40410195-40410217 CTGCGTGGCCCCTCAGATGCTGG + Exonic
1184489090 22:44799064-44799086 CTTGGGGGCCCCCCAGGTGGGGG - Intronic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
949559363 3:5187934-5187956 CGTCGGGGCTCCTCAGACGCTGG - Exonic
950447747 3:13047949-13047971 CTCCAGGGCCCCTGGGCTGCCGG - Intronic
950452293 3:13072230-13072252 CCTCTGGGACCCTCGGCTGCGGG - Intronic
950612849 3:14137279-14137301 CGCTGGGGACCCTCAGCTGCTGG - Intronic
952813901 3:37430603-37430625 CAGTCGGGCCCCTCAGCTGCAGG + Intronic
953750971 3:45608045-45608067 ATTGGGGGCAGCTCAGCTGCTGG + Intronic
953920451 3:46947947-46947969 CTTCAGGCTCCCTAAGCTGCAGG - Intronic
954441657 3:50525496-50525518 CTTCTTGGCACCTCAGCTGGGGG + Intergenic
954710764 3:52504124-52504146 CCACGGCGACCCTCAGCTGCAGG - Exonic
955014067 3:55051321-55051343 CAGAGGGGACCCTCAGCTGCAGG + Intronic
962392424 3:134984259-134984281 CTTGGTGGCCCCACAGCTGTGGG + Intronic
963666036 3:148187533-148187555 CTTCCTGGCTCCTCAGCTTCTGG - Intergenic
966669303 3:182509120-182509142 CTTCGGGGCCGTGCACCTGCCGG + Intergenic
973799188 4:54459661-54459683 CTAACAGGCCCCTCAGCTGCAGG - Intergenic
974350358 4:60736444-60736466 CAGCCGGGACCCTCAGCTGCAGG + Intergenic
976366991 4:84243863-84243885 ACTCGGGGCCCCACCGCTGCGGG - Intergenic
976585464 4:86791752-86791774 CTAACAGGCCCCTCAGCTGCAGG - Intronic
976655820 4:87488339-87488361 CTAAGAGGCCCCTCTGCTGCAGG + Intronic
977973980 4:103243291-103243313 CTTTCAGGACCCTCAGCTGCAGG + Intergenic
978464622 4:108994863-108994885 CTAACAGGCCCCTCAGCTGCAGG - Intronic
979326480 4:119385911-119385933 CTAACAGGCCCCTCAGCTGCAGG + Intergenic
982484721 4:155953568-155953590 CGTCTGGGGCCCTGAGCTGCGGG - Intronic
985367280 4:189245241-189245263 CAAATGGGCCCCTCAGCTGCAGG + Intergenic
986173670 5:5333926-5333948 CTCAGGCGCCCCTCAGCAGCAGG + Intergenic
986656285 5:10016265-10016287 CAGTCGGGCCCCTCAGCTGCAGG + Intergenic
986721138 5:10562788-10562810 CTCCGGGGCCCTGCAGATGCCGG + Intergenic
992448016 5:76851143-76851165 CTCCGATGCCCCTCAGCTCCTGG - Intronic
992509347 5:77417968-77417990 CTCCAGGGGCCATCAGCTGCAGG - Intronic
992675349 5:79101105-79101127 CTAACAGGCCCCTCAGCTGCAGG + Intronic
995154761 5:108897713-108897735 CTTCAGTGCATCTCAGCTGCTGG - Exonic
997107166 5:131033932-131033954 CAGCCGGGACCCTCAGCTGCAGG + Intergenic
997870105 5:137498997-137499019 CGCCGGGGACCCCCAGCTGCTGG - Intronic
998381843 5:141731248-141731270 CTTCGGGTCCCCTGGGCTGTGGG + Intergenic
1001083008 5:168680658-168680680 CTCCTGGCCCCCTCGGCTGCTGG + Intronic
1002661148 5:180791864-180791886 CTACGGTGCTCCCCAGCTGCAGG - Exonic
1004304602 6:14488386-14488408 CTTTGGGGCCCCACAGTTCCTGG + Intergenic
1004453699 6:15771327-15771349 CTTCTGGTCCCATCAGCAGCTGG - Intergenic
1004873711 6:19934348-19934370 GATAGGGGCCCCTGAGCTGCAGG - Intergenic
1007519773 6:42442487-42442509 CTGTGGGGCCCCTCAGCAGAGGG - Intronic
1009234748 6:61108639-61108661 CTTTCAGGACCCTCAGCTGCAGG - Intergenic
1010404694 6:75490954-75490976 CTTTGGAGCTTCTCAGCTGCAGG - Intronic
1010725135 6:79324847-79324869 GTTTGTGGACCCTCAGCTGCAGG + Intergenic
1010820590 6:80411190-80411212 CTAACAGGCCCCTCAGCTGCAGG + Intergenic
1013755495 6:113456823-113456845 CTTCTAGGCCCCTTTGCTGCAGG - Intergenic
1013762264 6:113531905-113531927 CATAGAGGACCCTCAGCTGCAGG - Intergenic
1013868346 6:114725943-114725965 CATAGAGGACCCTCAGCTGCAGG + Intergenic
1017864640 6:158432369-158432391 GTTCAGAGCCCCTGAGCTGCAGG - Intronic
1019171954 6:170137745-170137767 CCTCGGGGCCTTTCATCTGCAGG - Intergenic
1020089815 7:5332834-5332856 CCTTGGGGCCCCGCAGCTTCCGG + Exonic
1021579691 7:22139677-22139699 CTTCGAGGCCTCTCACTTGCAGG - Intronic
1023057324 7:36300670-36300692 CTTCACGGCCCATCAGCTCCAGG - Exonic
1026522798 7:71131684-71131706 CCTCCGGGCTCCTCAGCTCCGGG + Intergenic
1027843452 7:83342520-83342542 CAGTTGGGCCCCTCAGCTGCAGG - Intergenic
1028382259 7:90212173-90212195 CTGCGGGGTCCCTCATCTCCTGG + Intronic
1028786055 7:94795265-94795287 CAGAGAGGCCCCTCAGCTGCAGG - Intergenic
1029817084 7:103107146-103107168 CTTACAGGCCCCTCTGCTGCAGG - Intronic
1029851003 7:103461992-103462014 CTAACAGGCCCCTCAGCTGCAGG + Intergenic
1030166333 7:106559686-106559708 CTAAGAGACCCCTCAGCTGCAGG + Intergenic
1031366057 7:120901625-120901647 CTTTCAGGTCCCTCAGCTGCAGG - Intergenic
1033283710 7:140023272-140023294 GTTCAGGGCCCCTCACTTGCTGG - Intergenic
1035039032 7:155914145-155914167 CTTCTGGGCCCTTCAGGTGGAGG + Intergenic
1035206628 7:157297926-157297948 GTGAGGAGCCCCTCAGCTGCAGG + Intergenic
1035266004 7:157690617-157690639 CCTCGGGGCGCAGCAGCTGCGGG + Intronic
1035356082 7:158276738-158276760 CATCAGGGCCCCGCAGCAGCTGG - Intronic
1035452367 7:158985730-158985752 CTTGGGGGCCAGCCAGCTGCAGG + Intergenic
1036600238 8:10254072-10254094 CACCGAGGCCCCTCAGCTGCGGG + Intronic
1036769783 8:11571104-11571126 CTTTGGGGCCCCTCAAGTGCTGG - Intergenic
1037499877 8:19475279-19475301 CTTCTTGGCCCTTCAGCTTCAGG - Intronic
1037838361 8:22227697-22227719 CTCTCGGGCCCCTCACCTGCTGG - Intronic
1038451119 8:27639540-27639562 CTTAGGGCTCCCTCAACTGCAGG - Intronic
1038493450 8:27985840-27985862 CTTCTGGGCCCCTCCTCTGTGGG - Intronic
1041212764 8:55569364-55569386 CCTCTGTGGCCCTCAGCTGCAGG - Intergenic
1047170743 8:122490205-122490227 CTCTGTGGCCCCTCAGCAGCTGG + Intergenic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1048578362 8:135710453-135710475 TGTCTGGGCCTCTCAGCTGCTGG + Intergenic
1049604342 8:143522033-143522055 CTCTGGGGTCCCTCTGCTGCTGG + Intronic
1049651300 8:143771198-143771220 CCTCGGGGCTCCCGAGCTGCGGG + Intergenic
1051124916 9:13792533-13792555 CTAACAGGCCCCTCAGCTGCAGG - Intergenic
1052752849 9:32509494-32509516 CTAACAGGCCCCTCAGCTGCAGG - Intronic
1053168164 9:35859293-35859315 CTTAGGGTACCCTCTGCTGCAGG - Intergenic
1056348380 9:85722919-85722941 CAGTCGGGCCCCTCAGCTGCAGG + Intronic
1056539548 9:87559555-87559577 CTGGGAGGGCCCTCAGCTGCAGG - Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058498674 9:105589097-105589119 CTTCAGGGCCCCTCACTTGCAGG + Intronic
1062423771 9:136496854-136496876 ATTCAGGGCCCCTCCGCTGCTGG + Exonic
1062672432 9:137719407-137719429 CCTCAGGGGCCCACAGCTGCTGG + Intronic
1190649119 X:52551623-52551645 CAGTCGGGCCCCTCAGCTGCAGG - Intergenic
1191184122 X:57592180-57592202 CTTGGGGGCCCCGGAGCAGCAGG - Exonic
1194760400 X:97789242-97789264 CTTCAAGGCCCCTCATTTGCAGG + Intergenic
1195340504 X:103902332-103902354 CATTTGGGACCCTCAGCTGCAGG + Intergenic
1199435345 X:147806136-147806158 CTTGGTGGCCCCTCAGCTCTAGG - Intergenic
1200062259 X:153488860-153488882 GGGAGGGGCCCCTCAGCTGCAGG + Intronic
1202278033 Y:23145456-23145478 CTGAGAGGACCCTCAGCTGCAGG - Intronic
1202287170 Y:23263311-23263333 CTGAGAGGACCCTCAGCTGCAGG + Intronic
1202430858 Y:24776795-24776817 CTGAGAGGACCCTCAGCTGCAGG - Intronic
1202439111 Y:24881368-24881390 CTGAGAGGACCCTCAGCTGCAGG + Intronic