ID: 1112472429

View in Genome Browser
Species Human (GRCh38)
Location 13:99701146-99701168
Sequence CTCTGTGACCAAAAGTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112472426_1112472429 7 Left 1112472426 13:99701116-99701138 CCCTCAGGGGCAACCAAGTCTCT 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG 0: 1
1: 0
2: 0
3: 12
4: 154
1112472427_1112472429 6 Left 1112472427 13:99701117-99701139 CCTCAGGGGCAACCAAGTCTCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG 0: 1
1: 0
2: 0
3: 12
4: 154
1112472425_1112472429 16 Left 1112472425 13:99701107-99701129 CCTTGGGTGCCCTCAGGGGCAAC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG 0: 1
1: 0
2: 0
3: 12
4: 154
1112472428_1112472429 -6 Left 1112472428 13:99701129-99701151 CCAAGTCTCTAAATAATCTCTGT 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG 0: 1
1: 0
2: 0
3: 12
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112472429 Original CRISPR CTCTGTGACCAAAAGTACAT AGG Intronic
903753590 1:25645573-25645595 CTCAGTGACCACAAGCACACAGG + Intronic
907820963 1:57968191-57968213 CTCTGTGACAAACAGGACACAGG - Intronic
908742530 1:67343246-67343268 CTCTGTGACAAAAATTAGCTGGG - Intronic
909074400 1:71036220-71036242 CTCTTTGACCAGAAGTCCCTGGG - Intronic
909974815 1:82033231-82033253 CTCTGTGACAGAAACTGCATAGG - Intergenic
910985694 1:93002690-93002712 CTCTGTGACCCAAAGCACCATGG + Intergenic
911224174 1:95286602-95286624 CTCTGTGAACAAAAGCAGAAGGG - Intergenic
911236013 1:95413185-95413207 TACTGTGACCCAAAGCACATTGG + Intergenic
912132230 1:106617763-106617785 CTGTGTGGCAAAAAGTAAATGGG - Intergenic
915604836 1:156943926-156943948 CTCTGTGGCCACAGGTACCTGGG - Exonic
916389096 1:164310858-164310880 CTCTGTGAACCAAAGAACTTAGG - Intergenic
917414128 1:174790647-174790669 CTCTGTGAGCAAAATGACATTGG + Intronic
920177183 1:204109173-204109195 CTCCATGACCATAAGTACAAAGG - Intronic
920985423 1:210884592-210884614 TTCTCTCACCAAAAGTACATGGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063558276 10:7101393-7101415 ATCGGTGACTAAAAATACATTGG - Intergenic
1066454577 10:35561748-35561770 CCCTCTGTCCAAAGGTACATGGG - Intronic
1068792993 10:61047802-61047824 CTCTGTGACCAATAGTAAGTTGG - Intergenic
1070477816 10:76846981-76847003 CTCTGAGACCAAAATTCCAGAGG + Intergenic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1072849283 10:98870469-98870491 CTCTGTGAACAAAAGGCCACTGG + Intronic
1073184990 10:101610533-101610555 CTCTGTGTCCCAAAGAACAAAGG - Intergenic
1074203706 10:111261935-111261957 CTAAGTGACAAGAAGTACATTGG + Intergenic
1075227582 10:120643626-120643648 GTCTGTGCCTAAAAGTACATTGG - Intergenic
1076324799 10:129612910-129612932 AGCTGTGACCAGAAGCACATGGG - Intronic
1078135725 11:8650065-8650087 CTTTGTAACCAAAAGAACAGTGG + Intronic
1078248587 11:9598677-9598699 CTCTGTCACCCAGAGTACAGTGG - Intergenic
1079972610 11:27055185-27055207 CACAGTGACTAAAAGTAAATGGG - Intronic
1081217744 11:40422287-40422309 CTTAGTGATCAAAGGTACATTGG + Intronic
1084080674 11:66822177-66822199 ATGTGTTACCAAAAGTACACAGG - Intronic
1086737741 11:90327960-90327982 CTCTGTCACCCAAAGTGCAGTGG - Intergenic
1090503060 11:127280675-127280697 TTCTGTGACAAAAAGAACTTGGG + Intergenic
1091304214 11:134526933-134526955 CTCTGTAAGAAAAAGTACAGTGG - Intergenic
1091645212 12:2267886-2267908 CTCCGAGACCAAAAGAACAGTGG - Intronic
1092059480 12:5536757-5536779 TTCTGTGACCAAATATATATGGG - Intronic
1095087291 12:38070850-38070872 CTCTGTCACCCAAAGTGCAGTGG - Intergenic
1096027151 12:48376522-48376544 CTCTATGAGCAAAAATATATGGG + Intergenic
1097468629 12:59959475-59959497 TTCAGTGACAAAAAGAACATTGG - Intergenic
1097902033 12:64882849-64882871 CACTGTCACCGGAAGTACATGGG - Intergenic
1099101751 12:78450230-78450252 CTATGTGTCAAACAGTACATTGG - Intergenic
1099990637 12:89717305-89717327 CTCTGACACCAACAATACATAGG - Intergenic
1100456915 12:94760561-94760583 CTCAGTGACCAGAAGGGCATTGG - Intergenic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1103604227 12:122075154-122075176 CTCTGTCTCCAAAAATACACAGG - Intergenic
1109401683 13:61839142-61839164 CTCTGTGACCCTAACCACATTGG + Intergenic
1109703970 13:66064109-66064131 CTTTGTGACAAAAATTATATGGG + Intergenic
1110604640 13:77417920-77417942 ATATGAGACCAAAAGAACATAGG - Intergenic
1110689799 13:78419589-78419611 CTGTGTGACCATAAGGGCATTGG - Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1116091234 14:40309358-40309380 TTCTGTGATCAACAGTACAGAGG + Intergenic
1116976012 14:51116804-51116826 CTGAGTGTCCAAAAGTAAATTGG - Intergenic
1119969436 14:78952893-78952915 CTCTGTTTCCAAAAGTGTATGGG - Intronic
1121002299 14:90460627-90460649 CTCTGTCACCCAGAGTACAGTGG + Intergenic
1127490367 15:59456534-59456556 CCCTGTGAAAAAAAGCACATGGG - Intronic
1127777867 15:62282339-62282361 CACTGTGCCTAAAAGTACACAGG + Intergenic
1130842601 15:87715494-87715516 GTCTCTGACCAAAAGTTGATAGG - Intergenic
1131449100 15:92524476-92524498 CTCTGAGACCCAAAGGACAGGGG + Intergenic
1137582999 16:49645614-49645636 CTCTGTGACCAACAGGATTTTGG - Intronic
1138271011 16:55695863-55695885 CTCTGTGGCCATAAGGATATGGG - Intronic
1139034944 16:62933331-62933353 CTCTGTACTAAAAAGTACATGGG - Intergenic
1143761546 17:9107790-9107812 CACTGTGACAAAAACTGCATGGG + Intronic
1147330848 17:39698575-39698597 CTCTGGGACCAAGAGGACCTGGG - Intronic
1148186808 17:45650346-45650368 CTCTGTGGCCAATTGTGCATCGG + Intergenic
1148594975 17:48846567-48846589 CACTGTGACCAAAATATCATTGG - Intronic
1150980943 17:70140797-70140819 CTATCTGACCAAAATTACTTTGG + Intergenic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1153438177 18:5088681-5088703 CTCAATGGTCAAAAGTACATGGG - Intergenic
1155596575 18:27494888-27494910 TTCTGTGAACACAAGTACCTTGG + Intergenic
1155640134 18:28003746-28003768 CTCAGTGATTAAAAGAACATTGG + Intronic
1158056174 18:53283950-53283972 CACTATGATGAAAAGTACATAGG + Intronic
1159501297 18:69274331-69274353 TTTTGTGACAAAAAGAACATGGG + Intergenic
1160132935 18:76245888-76245910 GGCTGTGTCCAAAAGTACAAAGG - Intergenic
1161499378 19:4605163-4605185 CTCTGAGACGAAAAGAAAATGGG - Intergenic
1165176270 19:33932465-33932487 CTCTGCGAACAAAGGTACATTGG + Intergenic
1165252144 19:34547890-34547912 CTCTGTCCCCAAAAGAACATAGG + Intergenic
1165268351 19:34680604-34680626 CTCAGTTCCCAAAAGAACATAGG - Intronic
1167881065 19:52457702-52457724 CTCTGTGACTAAATGTATGTGGG - Intronic
926713136 2:15899400-15899422 ATCTGATACGAAAAGTACATTGG + Intergenic
927522101 2:23705184-23705206 CTCTGAGACTAGAAGTAAATGGG + Intronic
928345090 2:30485705-30485727 CTCTGTAACCTATAGTAAATAGG + Intronic
928923209 2:36548001-36548023 TTCTTTGAACAAATGTACATTGG + Intronic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
932356222 2:71070516-71070538 CTCTGAGACTAAAAGGACCTCGG - Exonic
932612667 2:73211370-73211392 TTCTGTGACCAAACGTATAGGGG + Exonic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
939214287 2:139216074-139216096 CTCTGCGACCTATTGTACATGGG + Intergenic
939556364 2:143678551-143678573 ATCTCTGCCCAAAACTACATAGG + Intronic
940695088 2:156967688-156967710 CTCTGAGACAAAAATTACAGAGG - Intergenic
940883243 2:158968311-158968333 CTCTGGGACCAAAATGAGATGGG - Intergenic
941599643 2:167525941-167525963 GACTGTGATCAAAAGGACATAGG - Intergenic
941891481 2:170586273-170586295 CCCTGTGACCTAAAGTTCACAGG + Intronic
942495514 2:176535805-176535827 CTCTGTAATAGAAAGTACATAGG - Intergenic
943287292 2:186018251-186018273 CTCTGAGATCAAATGTACGTTGG - Intergenic
943990511 2:194684004-194684026 CTCTGTGACAACTAGTGCATTGG + Intergenic
945304077 2:208241985-208242007 CTCTGTGGCCCAAGGTACAGAGG - Exonic
945741504 2:213668672-213668694 CTCTGTCACCCAGAGTACAATGG + Intronic
946596041 2:221307208-221307230 CTATGTCCCCAAAATTACATGGG - Intergenic
947424442 2:229970615-229970637 CTCTGTGACATCAAGAACATTGG - Intronic
1169542786 20:6618780-6618802 ATCTGTGACCAAATGTGTATGGG + Intergenic
1178907269 21:36647007-36647029 CTCTGAGACCCAAAATAAATAGG - Intergenic
1183290472 22:36999070-36999092 CACTGTGACCAAAGGTGCCTGGG + Intronic
1184865037 22:47197518-47197540 CTCTGTGACCAAAGCCACACTGG - Intergenic
949289036 3:2442185-2442207 CAATGTGACCAAAATGACATAGG - Intronic
949976761 3:9467847-9467869 CTCTGTTGCCAAAAGTACAATGG + Intronic
951261823 3:20518706-20518728 CTATGTGACCAATAGTGTATAGG + Intergenic
952332204 3:32374517-32374539 CTCTGTTACCCAGAGTACAGTGG + Intergenic
954124092 3:48518543-48518565 CTCTGGGACCAAAAGAACTCAGG + Exonic
956266750 3:67405041-67405063 CTCTGTTCCCAAAAGCACTTGGG - Intronic
956683854 3:71806287-71806309 TTCTGAGAGCAATAGTACATTGG + Intergenic
957934162 3:86920967-86920989 CTCTGTGACCAGAATGAGATTGG + Intergenic
958590649 3:96154532-96154554 CTCTGTCAGCCAAAGAACATTGG - Intergenic
961123067 3:124390476-124390498 CTCTGGAACCAAAACTAAATTGG + Intronic
963098867 3:141578628-141578650 CCCTGTGAACAAAAGGACACTGG - Intronic
964276524 3:155014014-155014036 CTCTGTGACCTGAAGCTCATAGG - Intergenic
966216278 3:177506484-177506506 CTCTGTGACCTTAAGTAAAGTGG - Intergenic
970112126 4:12650634-12650656 ATCTGTGACCAAATGCACATGGG - Intergenic
970949383 4:21735691-21735713 TTCTCTGACCAAGAGTAGATAGG - Intronic
973800185 4:54470194-54470216 CTCTCTGAGGAAAAGTACTTAGG - Intergenic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
978640275 4:110862482-110862504 CTCTGTGCCCAGAAATACCTGGG + Intergenic
981045302 4:140259244-140259266 CTCAGTGACCAACTGGACATGGG - Intronic
987378197 5:17257666-17257688 CTCTGTGAAAAAAAGCACATAGG - Intronic
988559382 5:32266729-32266751 TTCCCTGACAAAAAGTACATAGG + Intronic
989836593 5:46001229-46001251 CTCTGTTACCAAATTTAAATGGG + Intergenic
989953627 5:50330850-50330872 CTCTGAGACAAAACGTACAGAGG + Intergenic
990662671 5:58034807-58034829 GTCTGTGACCAAAAGAAGAAAGG - Intergenic
991079802 5:62586094-62586116 CTCTGTAACCCTAAGTACACTGG - Intronic
994109170 5:95981060-95981082 CTATGGGACCCAAAGTACAAGGG + Intergenic
996851547 5:127958611-127958633 ATCTTTGACCAACAGTACGTTGG - Intergenic
996888731 5:128391085-128391107 CTCTGTTACATAAAGTCCATTGG - Intronic
999410712 5:151347436-151347458 GTCTGTGACAAAAAGTACTGAGG - Exonic
1005891152 6:30139671-30139693 CTCACTGACCAAATGGACATGGG - Intronic
1009594422 6:65716353-65716375 TTCTGTGACCAAATGTACACGGG + Intergenic
1009943318 6:70315152-70315174 CTCTGTGTCCAGAATTACACTGG + Intergenic
1011811662 6:91139200-91139222 GACTGTGACAAAATGTACATGGG - Intergenic
1016973835 6:149787727-149787749 CTGTGTGGACAAAAGTACACAGG - Intronic
1017124215 6:151050735-151050757 TTCTGTGACCAAATGTGTATGGG - Intronic
1019290782 7:249023-249045 CTCTGTGCACAGAAGGACATTGG - Intronic
1021615266 7:22497569-22497591 CTCTGTGACCAACATTAAAGAGG + Intronic
1021741328 7:23688598-23688620 CACTGTGACAAAAATAACATTGG + Intronic
1022431405 7:30325887-30325909 ATTTGTGACTAAAAGTATATGGG + Intronic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1028377227 7:90157064-90157086 CTCTGTGACCAACATTAAAGAGG - Intronic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1032406090 7:131656809-131656831 CTCCATGACCAAATGTACCTGGG - Intergenic
1032514081 7:132494227-132494249 CTTTGTGACCAAATGTCTATCGG - Intronic
1036030832 8:4970441-4970463 TTATGTGACCAAAATGACATCGG + Intronic
1036975073 8:13401693-13401715 CAATGTGACAAAAAGTACACTGG + Intronic
1037124127 8:15324433-15324455 CTCTGTGATCTAGAGTAAATTGG - Intergenic
1038738959 8:30199648-30199670 CTCTGTGAGCACAAGTACACAGG + Intergenic
1039712183 8:40067163-40067185 ATCTGTGACCCACAGAACATTGG - Intergenic
1039919583 8:41883819-41883841 CTCTGTGTCCAAAGCTACACAGG + Intronic
1043023052 8:75028983-75029005 CACTCTGACCAAATGTTCATAGG - Intronic
1047028426 8:120849911-120849933 TTCTGTGATGAAAAATACATTGG - Intergenic
1048840246 8:138559212-138559234 CTCTGTGAACAAAAATAGAGAGG - Intergenic
1050712205 9:8477832-8477854 CTCTGTGCCCATAAGTTTATTGG - Intronic
1052182345 9:25545378-25545400 TTCTGTGACCAAATGTATGTGGG + Intergenic
1057007777 9:91575778-91575800 CTCTGTACCCAAAAGAAAATTGG + Intronic
1057123935 9:92601563-92601585 CGCTGTGACCAAAAGGACAGAGG + Intronic
1060071048 9:120547732-120547754 GTGTGTGAACAAAAGGACATAGG + Intronic
1060693039 9:125681769-125681791 CTCTGTAAACAAACATACATAGG - Intronic
1061608770 9:131732042-131732064 CTCTGTGAGCTAAGGTACAGGGG - Intronic
1193649070 X:84108730-84108752 CTCAGGGATCAAAAGTCCATGGG - Intronic
1195225134 X:102784854-102784876 CACTGTGACCTAAAGTGCTTGGG - Intergenic
1195914820 X:109925743-109925765 CTATGTAAGAAAAAGTACATGGG - Intergenic
1195942565 X:110178045-110178067 CTCTGGTACCCAAAGTGCATTGG + Intronic
1196255449 X:113512924-113512946 CTGTGTGACCCAGAATACATAGG - Intergenic